Rice mapk6 gene mutant and its application
A technology for rice and rice grains, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problem of not knowing whether the grains are getting bigger or smaller.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Obtaining of DN-OsMAPK6 Encoding Gene and CA-OsMAPK6 Encoding Gene
[0028] 1. Extract RNA
[0029] The leaves of rice Zhonghua 11 were crushed with liquid nitrogen, and the total RNA was extracted with the Plant Total RNA Extraction Kit (TIANGEN). The obtained total RNA was detected by a spectrophotometer (Eppendorf, Germany) to detect the concentration of total RNA in the sample.
[0030] 2. Acquisition of DN-OsMAPK6 coding gene
[0031] According to the OsMAPK6 gene sequence on RAP-DB (http: / / rapdb.dna.affrc.go.jp / ), two pairs of primers were designed as follows:
[0032] OsMAPK6-F1: GGCTGCAGGAATTCAAGCTTATGGACGCCGGGGCGCAGC
[0033] OsMAPK6-R2: CAGATCAGTATCCATCAATTCACATGCAATATAAACGTCATTGA
[0034] DN-OsMAPK6-F: GCTGAGTTTGTTGTCACAAGATGGTAT
[0035] DN-OsMAPK6-R:CCATCTTGTGACAACAAACTCAGCCATAAAATCGGTTTCTGAGGT
[0036] Take 5 μg of total RNA, reverse transcription with a reverse transcription kit (Invitrogen), use the cDNA obtained by reverse transcription ...
Embodiment 2
[0046] Example 2 Construction of DN-OsMAPK6 and CA-OsMAPK6 expression vectors
[0047] Using the seamless cloning kit (TIANGEN), the fragment A and fragment B recovered in Example 1 were seamlessly cloned with pIPKB003 at the same time, and the ligated product was transformed into Escherichia coli DH5α competent cells, according to the spectinomycin resistance marker on the carrier Positive clones were screened to obtain a recombinant plasmid containing the fusion of A and B fragments, which was named pIPKB003-DN-OsMAPK6.
[0048] Using the seamless cloning kit (TIANGEN), the fragments C and D recovered in Example 1 were seamlessly cloned with pIPKB003 at the same time, and the ligated product was transformed into Escherichia coli DH5α competent cells, and screened according to the spectinomycin resistance marker on the carrier Positive clones obtained a recombinant plasmid containing the fusion of C and D fragments, named pIPKB003-CA-OsMAPK6.
[0049] Introduce pIPKB003-DN-O...
Embodiment 3
[0051] The acquisition of embodiment 3 transgenic plants
[0052] The rice variety Zhonghua 11 was transformed with GV3101-DN-OsMAPK6 and GV3101-CA-OsMAPK6 to obtain transgenic plants transgenic for DN-OsMAPK6 and CA-OsMAPK6, respectively. The specific operation is as follows:
[0053] 1. Induction culture of rice mature embryo callus: the shelled mature rice seeds are first soaked in 70% ethanol for 1-2 minutes, then soaked in 0.1% mercury chloride for 10 minutes, sterilized on the surface, and rinsed with sterile water for 3-4 times , and then put the seeds on sterile filter paper to absorb water, put them on mature embryo callus induction medium, and cultivate them in the dark at 26°C. After about 10-15 days, the callus grown from the mature embryo scutellum was peeled off, transferred to the mature embryo subculture medium, and subcultured under the same conditions. Subculture every two weeks thereafter. Select subcultured 5-7 days callus with light yellow color for co-...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


