New antimycin biosynthetic pathway ketoreductase gene deletion strain, construction method and application
A biosynthetic and neoantimycin technology, applied in the field of medical bioengineering, can solve the problems of structural characterization of anti-tumor activity or other unknown drug effects, no literature reports, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Construction of embodiment 1 mutant strain RJ8
[0045] The principle process of the construction of the mutant strain RJ8 is as follows: figure 1 As shown, in the present invention, the mutant strain RJ8 with natE gene deletion is obtained after homologous recombination double exchange between the plasmid carrying the homologous recombination fragment and the target region of the chromosome of the host bacteria (WT).
[0046] Specifically, it is realized through the following steps:
[0047] a) Construction of natE gene knockout plasmid
[0048] Using Streptomyces S. conglobatus genomic DNA as a template, a 1105bp homologous recombination left arm PCR fragment (SEQ ID NO.7) and a 1089bp homologous recombination right arm PCR fragment (SEQ ID NO.8) were obtained by PCR amplification, The left arm fragment overlaps the XbaI cut end of pRJ2 by 25 bases (ATCCCCGGGGACCTGCAGGTCGACT); the right arm fragment overlaps the EcoRI cut end of pRJ2 by 26 bases (TATCACGAGGCCCTT...
Embodiment 2
[0059] Escherichia coli E.coli DH5a or E.coli JM109 was selected as the host bacteria to construct the plasmid pRJ28 containing the homologous recombination fragment (see Example 1a for the construction process). Escherichia coli E.coliJTU007 (A Non-Restricting and Non-Methylating Escherichia coli Strain for DNA Cloning and High-Throughput Conjugation to Streptomyces coelicolor, CurrMicrobiol (2012) 64, 185–190) without DNA methylation modification system was selected, and the plasmid pRJ28 was transformed into Inject E.coli JTU007 containing plasmid pUZ8002 to obtain pRJ28+pUZ8002 / E.coli JTU007. Transform pRJ28+pUZ8002 / E.coli JTU007 into Streptomyces S. conglobatus and screen the mutant strain RJ8 (see Example 1c for the screening process).
Embodiment 3
[0061] By designing the position of the homologous recombination fragment inside the gene natE, the deletion mutation of different regions inside the gene natE can be realized. For example, keeping the left arm of the homologous recombination described in "Example 1a" unchanged, and only adjusting the position of the right arm of the homologous recombination inside natE, the 1074bp (SEQ ID NO.14) region inside the mutant gene natE can be deleted. The right arm of the homologous recombination is a PCR product of 1206bp (SEQ ID NO.15), and the PCR primers are R-F (SEQ ID NO.16) and R-R (SEQ ID NO.17). The remaining steps are the same as "Example 1".
[0062] The sequences involved in the above three embodiments are shown in Table 1:
[0063] Table 1 DNA sequence list
[0064]
[0065]
[0066]
[0067]
[0068]
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More