Unlock instant, AI-driven research and patent intelligence for your innovation.
Thrombopoietin fusion protein, preparation method and applications thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of thrombopoietin and fusion protein, applied in the field of genetic engineering pharmaceuticals, can solve the problems of immaturity and unpredictable results, achieve long half-life and promote the effect of platelet production
Inactive Publication Date: 2018-10-09
LANZHOU UNIVERSITY
View PDF6 Cites 2 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
On the other hand, the expression of recombinant proteins is also affected by factors such as hosts, culture conditions, secretion pathways, and promoters. The current gene optimization theory and design methods are still immature, and there are various limitations. Gene optimization strategies It is a necessary but not sufficient condition for increasing the expression of recombinant proteins
To sum up, there is great uncertainty in the actual production and application of the strategy of improving the expression of genetically engineered strains through modification of yeast preferred codons, and the final result of modification for different target genes is unpredictable
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0064] Example 1 Construction and expression of HSA-TMP fusion protein yeast expression vector
[0065] 1. Obtaining p29-simple-TMP sequence
[0066] 1. First encode according to the preferred codon pair of Pichia methanolophila (TMP) 2 The sequence of the gene is optimized.
[0067] 2. Entrust Dalian Takara Company to synthesize optimized (TMP) 2 Gene, (TMP) 2 The DNA sequence is as shown in SEQ ID NO:1, and loaded into p29-simple (p29-simple plasmid vector Dalian Takara company provides) to obtain the vector p29-simple-(TMP) 2 .
[0068] 3. The p29-simple-TMP already contains L, that is, the connecting peptide, the LDNA sequence is GGCGGCGGCGGTTCCGGACTGGAGCCCAAGAGCTGCGACAAGACCCACACCTGCCCTCCCTGCGAATTCGGTGGTGGCGGCAGC, and the amino acid sequence is GGGGSGLEPKSCDKTHTCPPCEF GGGGS.
[0070] Obtained from the plasmid pcDNA3.1-fip-HSA clone (the HSA gene sequence was synthesized by the whole gene of Bao Biology, and the pcDNA3.1 plasmid was purch...
[0085] Cells were plated, c-mpl, c-fos, pAdVAntage, Renilla, four plasmids were co-transfected. 48h after transfection, the positive control, blank control and test samples were added to detect the firefly luciferase activity and Renilla luciferase activity, and calculate the fluorescence ratio.
[0086] Positive control: TPIAO TPIAO (recombinant human thrombopoietin injection) purchased from Shenyang Sansheng Pharmaceutical Co., Ltd.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention belongs to the field of genetic engineering and pharmacy, and relates to a thrombopoietinfusion protein, a preparation method and applications thereof, particularly to a fusion proteinof a thrombopoietin mimetic peptide (TMP) diad encoded by a yeast preference codon and human serum albumin (HSA), a preparation method and applications thereof. According to the present invention, thefusion protein contains the HSA molecule and the TMP diad encoded by the yeast preference codon, wherein the HSA molecule is located at the N-terminal of the fusion protein, and the TMP diad encodedby the yeast preference codon is located at the C-terminal of the fusion protein; the fusion protein can be highly and stably expressed in yeast, and can be applied to industrial production; and the fusion protein can significantly promote the platelet production, has long half-life in the human body, and can be used for preparing drugs for treatment of various primary or secondary thrombocytopenia and other diseases.
Description
Technical field [0001] The invention belongs to the field of genetic engineeringpharmacy, and relates to a thrombopoietin fusion protein and a preparation method and application thereof, in particular to a thrombopoietin mimetic peptide (Thrombopoietin Mimetic Peptide, TMP) doublet encoded by a yeast preference codon Fusion protein with human serum albumin (Human serum Albumin, HSA). Background technique [0002] Clinically, it is common to encounter primary and secondary thrombocytopenia caused by various reasons, such as primary thrombocytopenic purpura, aplastic anemia, and thrombocytopenia caused by tumorization / radiotherapy. For this type of disease, it is more suitable to use long-acting platelet-boosting drugs for treatment. On the one hand, it can reduce the number of medications and reduce the pain of acupuncture; on the other hand, it can reduce the dosage of drugs and reduce the treatment cost. [0003] Platelets are produced by megakaryocytes. Promoting the proliferat...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More 
