Thrombopoietin fusion protein, preparation method and applications thereof

A technology of thrombopoietin and fusion protein, applied in the field of genetic engineering pharmaceuticals, can solve the problems of immaturity and unpredictable results, achieve long half-life and promote the effect of platelet production

Inactive Publication Date: 2018-10-09
LANZHOU UNIVERSITY
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the other hand, the expression of recombinant proteins is also affected by factors such as hosts, culture conditions, secretion pathways, and promoters. The current gene optimization theory and design methods are still immature, and there are various limitations. Gene optimization strategies It is a necessary but not sufficient condition for increasing the expression of recombinant proteins
To sum up, there is great uncertainty in the actual production and application of the strategy of improving the expression of genetically engineered strains through modification of yeast preferred codons, and the final result of modification for different target genes is unpredictable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thrombopoietin fusion protein, preparation method and applications thereof
  • Thrombopoietin fusion protein, preparation method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1 Construction and expression of HSA-TMP fusion protein yeast expression vector

[0065] 1. Obtaining p29-simple-TMP sequence

[0066] 1. First encode according to the preferred codon pair of Pichia methanolophila (TMP) 2 The sequence of the gene is optimized.

[0067] 2. Entrust Dalian Takara Company to synthesize optimized (TMP) 2 Gene, (TMP) 2 The DNA sequence is as shown in SEQ ID NO:1, and loaded into p29-simple (p29-simple plasmid vector Dalian Takara company provides) to obtain the vector p29-simple-(TMP) 2 .

[0068] 3. The p29-simple-TMP already contains L, that is, the connecting peptide, the LDNA sequence is GGCGGCGGCGGTTCCGGACTGGAGCCCAAGAGCTGCGACAAGACCCACACCTGCCCTCCCTGCGAATTCGGTGGTGGCGGCAGC, and the amino acid sequence is GGGGSGLEPKSCDKTHTCPPCEF GGGGS.

[0069] 2. The cloning of HSA cDNA fragments:

[0070] Obtained from the plasmid pcDNA3.1-fip-HSA clone (the HSA gene sequence was synthesized by the whole gene of Bao Biology, and the pcDNA3.1 plasmid was purch...

Embodiment 2

[0083] Example 2HSA-(TMP) 2 Biological activity detection of fusion protein

[0084] 1. Experimental process

[0085] Cells were plated, c-mpl, c-fos, pAdVAntage, Renilla, four plasmids were co-transfected. 48h after transfection, the positive control, blank control and test samples were added to detect the firefly luciferase activity and Renilla luciferase activity, and calculate the fluorescence ratio.

[0086] Positive control: TPIAO TPIAO (recombinant human thrombopoietin injection) purchased from Shenyang Sansheng Pharmaceutical Co., Ltd.

[0087] Blank control: serum

[0088] Fluorescence ratio = firefly fluorescence value / renilla fluorescence value.

[0089] For specific steps, see Chinese Patent (CN201310084212).

[0090] 2. Experimental results

[0091] Table 1HSA-(TMP) 2 Results of biological activity test of fusion protein

[0092] test group

Relative fluorescence ratio

Blank control group

1.00±0.02

Positive control group

1.44±0.12

Yeast strain 1-1

1.37±0.05

Yeas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering and pharmacy, and relates to a thrombopoietin fusion protein, a preparation method and applications thereof, particularly to a fusion proteinof a thrombopoietin mimetic peptide (TMP) diad encoded by a yeast preference codon and human serum albumin (HSA), a preparation method and applications thereof. According to the present invention, thefusion protein contains the HSA molecule and the TMP diad encoded by the yeast preference codon, wherein the HSA molecule is located at the N-terminal of the fusion protein, and the TMP diad encodedby the yeast preference codon is located at the C-terminal of the fusion protein; the fusion protein can be highly and stably expressed in yeast, and can be applied to industrial production; and the fusion protein can significantly promote the platelet production, has long half-life in the human body, and can be used for preparing drugs for treatment of various primary or secondary thrombocytopenia and other diseases.

Description

Technical field [0001] The invention belongs to the field of genetic engineering pharmacy, and relates to a thrombopoietin fusion protein and a preparation method and application thereof, in particular to a thrombopoietin mimetic peptide (Thrombopoietin Mimetic Peptide, TMP) doublet encoded by a yeast preference codon Fusion protein with human serum albumin (Human serum Albumin, HSA). Background technique [0002] Clinically, it is common to encounter primary and secondary thrombocytopenia caused by various reasons, such as primary thrombocytopenic purpura, aplastic anemia, and thrombocytopenia caused by tumorization / radiotherapy. For this type of disease, it is more suitable to use long-acting platelet-boosting drugs for treatment. On the one hand, it can reduce the number of medications and reduce the pain of acupuncture; on the other hand, it can reduce the dosage of drugs and reduce the treatment cost. [0003] Platelets are produced by megakaryocytes. Promoting the proliferat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/81A61K38/19A61P7/04C12R1/84
CPCA61K38/00C07K14/524C07K2319/31C12N15/815C12N2800/22
Inventor李红玉张丽芸王梅竹支德娟李洋赵晶
OwnerLANZHOU UNIVERSITY