Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Display system of chitosanase cell surface and preparation and application thereof

A technology of chitosan enzyme and cell surface, which is applied in the field of bioengineering, can solve the problems of complex chitosan oligosaccharide process and difficult separation of chitosan and reaction products, and achieve the effect of saving cumbersome steps and reducing costs

Inactive Publication Date: 2018-10-12
SHANGHAI INST OF TECH
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The object of the present invention is to provide a chitosanase cell surface display system and its preparation and application, said this chitosanase cell surface display system and its preparation and application will solve the problem of producing chitosan in the prior art The technical problems of complex process and difficult separation of chitosan and reaction products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Display system of chitosanase cell surface and preparation and application thereof
  • Display system of chitosanase cell surface and preparation and application thereof
  • Display system of chitosanase cell surface and preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] 1. Cloning of csn and inaQN gene fragments

[0047] According to the published Bacillus subtilis chitosanase gene sequence design primer (called P1 and P2) according to the National Biotechnology Information Center of the United States, according to the gene sequence of the inaQ published in GenBank, design primer (called P3 and P4), respectively Using the genomic DNA of Bacillus subtilis and Pseudomonas syringae MB03 as templates, PCR amplification was carried out to obtain the csn gene fragment and the inaQN gene fragment respectively.

[0048] P1(5'→3'): AGATCT GCGGGACTGAATAAAGATC

[0049] P2(5'→3'): GAATTC TTATTTGATTACAAAATTACCG

[0050] P3(5'→3'): CCATGG ATCTCGACAAGGCG

[0051] P4(5'→3'): AGATCT GGTCTGCAAATTCTGCGG

[0052] Primers P1 and P4 contain a Bgl II restriction site, primer P2 contains an EcoR I restriction site, and primer P3 contains a Nco I restriction site.

[0053] The PCR reaction conditions were: pre-denaturation at 94°C for 3 min; denatu...

Embodiment 2

[0061] The average relative molecular mass is 4.1×10 5 Da chitosan was prepared into a 0.1% solution with acetic acid-sodium acetate buffer solution of pH 6.0, and the above-mentioned spare bacterial suspension was centrifuged at 12000×g for 2 min at 4°C, and the supernatant was discarded, suspended in the same volume of the above-mentioned 0.1 % chitosan solution, react in a oscillating constant temperature water bath at 30-37°C, use the viscosity method to detect the relative molecular weight every 20 minutes, and react for 2 hours. After 100 minutes of reaction, the relative molecular weight of chitosan changes from the initial 4.1×10 5 Da down to 5.0×10 3 Da left and right. Such as Figure 4 shown. It can be seen that the degradation efficiency of chitosan is high and the speed is fast.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Average relative molecular weightaaaaaaaaaa
Relative molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a display system of a chitosanase cell surface. A fused gene segment is obtained by fusing a gene csn and a gene inaQN, wherein the gene csn is coded with chitosanase and the gene inaQN of an N-terminal structural domain of an ice nucleating protein is responsible for transmembrane transport and has an anchoring function. The fused gene segment is expressed on the surface ofa host cell, and the display system of the chitosanase cell surface is obtained. The nucleotide sequence of the gene csn is showed as SEQID NO.1. The nucleotide sequence of the gene inaQN is showed as SEQIDNO. 2. The invention further provides a preparation method of the display system of the chitosanase cell surface. The display system of the chitosanase cell surface can directly react with thechitosan in a solution, tedious steps of protein purification are saved, and cost of producing low-molecular-weight chitosan and oligomeric chitosan is reduced greatly. The display system of the chitosanase cell surface has great application prospects in the field of low molecular weight chitosan and oligomeric chitosan preparation.

Description

technical field [0001] The invention belongs to the technical field of bioengineering and relates to chitosan, in particular to a chitosanase cell surface display system and its preparation and application. Background technique [0002] Chitosan is a basic polysaccharide composed of D-glucosamine (GlcN) linked by β-1,4-glycosidic bonds. Because of its good biocompatibility, chitosan is widely used in food, medicine, textile, agriculture and other aspects. Chitooligosaccharides, also known as oligoglucosamine, oligoglucosamine, etc., are water-soluble amino sugar compounds produced by hydrolysis of chitosan with a low degree of polymerization (generally 2-20 degrees of polymerization). Compared with macromolecular chitosan, it has small molecular weight, good water solubility, easy absorption and utilization, unique physiological activity and function, and is widely used in medicine, food, cosmetics, agriculture and other fields. [0003] At present, the methods for produci...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/24C12N15/70C12N1/21C12N15/56C12P19/26C12P19/14C12P19/12C12R1/19
CPCC12N9/2402C12P19/12C12P19/14C12P19/26C12Y302/01132
Inventor 李茜茜刘颖颖荣绍丰管世敏侯永泰蔡宝国张硕时丽
Owner SHANGHAI INST OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com