Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for screening tobacco black shank resistance non-homologous chromosome plant by molecular marker

A technology of heterologous chromosomes and molecular markers, which is applied in the field of tobacco breeding and can solve problems such as inability to apply screening

Inactive Publication Date: 2018-11-06
SOUTHWEST UNIVERSITY +1
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The development and application of resistance linkage markers are only seen in some derived lines, and most of these derived materials are common tobacco, whose genome is different from that of blue jasmine leaf, and because of the black shank resistance of blue jasmine leaf After infiltration into common tobacco, its linkage relationship with related molecular markers has changed, so such molecular markers cannot be applied to the screening of distant hybrid offspring

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for screening tobacco black shank resistance non-homologous chromosome plant by molecular marker
  • Method for screening tobacco black shank resistance non-homologous chromosome plant by molecular marker
  • Method for screening tobacco black shank resistance non-homologous chromosome plant by molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019]By screening 340 pairs of SSR primers from existing tobacco (N.tabacum), the screening process is as follows: extract plants (N.plumbaginifolia, anti-blackleg heterologous monomer addition lines TP-1 and Yunyan 87) by CTAB method The genomic DNA was detected by a nucleic acid concentration analyzer and agarose gel electrophoresis to detect no impurities and no degradation before PCR amplification; using the extracted genomic DNA as a template, PCR amplification was performed using 334 pairs of primers such as PT30061, PT30167, and PT54199. Amplification system: 15 μL of PCR amplification system was used, which contained 2 μL of 10× buffer (Takara Company), MgCl2 1.2 μL (25 mmol / L, Takara Company), dNTP 0.4 μL (10 mmol / L, Takara Company), rTaq 0.2 μL (5 U / μL, Takara Company), 1.5 μL of DNA template, 1.5 μl each of forward and reverse primers (10 μmol / L), and make up the rest with water. Amplification program: pre-denaturation at 94°C for 5min, denaturation at 94°C for 40s...

Embodiment 2

[0021] 1. Genomic DNA extraction: The DNA of the plant (black shank resistance tobacco-blue jasmine leaf tobacco heterologous monomer addition line self-bred progeny) was extracted by CTAB method, and no impurities and no impurities were detected by nucleic acid concentration analyzer and agarose gel electrophoresis. Perform PCR amplification after degradation;

[0022] 2. PCR amplification and electrophoresis: use the extracted genomic DNA as a template and primer PT54199 (PF: GCACTTCGTAGATGCGTTGA, PR: TCTCATGAGCAGGCTTCAAA) for PCR amplification, amplification system: use 15 μL of PCR amplification system, which contains 2 μL of 10 ×buffer (Takara Company), MgCl2 1.2μL (25mmol / L, Takara Company), dNTP 0.4μL (10mmol / L, Takara Company), rTaq 0.2μL (5U / μL, Takara Company), 1.5μL DNA template, positive 1.5 μl of each reverse primer (10 μmol / L), and make up the rest with water. Amplification program: pre-denaturation at 94°C for 5min, denaturation at 94°C for 40s, annealing at 56...

Embodiment 3

[0026] 1. Genomic DNA extraction: The DNA of the plant (the offspring of the allopentaploid backcross Yunyan 87 resistant to black shank tobacco-blue jasmine leaf tobacco) was extracted by the CTAB method, and no impurities were detected by the nucleic acid concentration analyzer and agarose gel electrophoresis , PCR amplification without degradation;

[0027] 2. PCR amplification and electrophoresis: use the extracted genomic DNA as a template and primer PT54199 (PF: GCACTTCGTAGATGCGTTGA, PR: TCTCATGAGCAGGCTTCAAA) for PCR amplification, amplification system: use 15 μL of PCR amplification system, which contains 2 μL of 10 ×buffer (Takara Company), MgCl2 1.2μL (25mmol / L, Takara Company), dNTP 0.4μL (10mmol / L, Takara Company), rTaq 0.2μL (5U / μL, Takara Company), 1.5μL DNA template, positive 1.5 μl of each reverse primer (10 μmol / L), and make up the rest with water. Amplification program: pre-denaturation at 94°C for 5min, denaturation at 94°C for 40s, annealing at 56°C for 30s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for screening a tobacco black shank resistance non-homologous chromosome plant by a molecular marker. The black shank resistance non-homologous chromosome plant is screened in Nicotiana tabcum-N.plumbaginifolia distant hybridization descendants by molecular marker tobacco. Through black shank resistance identification and genome in situ hybridization confirmation, the method disclosed by the invention can carry out screen in the backcross descendants of Nicotiana tabcum-N.plumbaginifolia sesquialter diploid plants to obtain the black shank resistance plant withan exogenous chromosome, and an accuracy rate can be 100%. The result shows that the molecular marker can be used for screening to obtain the black shank resistance plant with the Nicotiana tabcum-N.plumbaginifolia chromosome, i.e., an in situ hybridization method can be replaced for screening.

Description

technical field [0001] The invention relates to tobacco breeding, in particular to a method for quickly screening heterologous chromosomes resistant to black shank in tobacco by using molecular markers. Background technique [0002] Tobacco black shank is a soil-borne fungal disease caused by Phytophthora parasitica var nicotianae, and it is one of the main diseases that affect the yield and quality of tobacco. It can destroy the entire tobacco field, and it is extremely destructive. After field infection, the whole tobacco plant often dies, causing huge economic losses (Wang Wanneng, Xiao Chonggang. Comprehensive prevention and control of tobacco black shank and its research progress. Guangxi Agricultural Sciences, 2003(2):42-43.). One of the safest and most cost-effective measures to control tobacco black shank is to breed disease-resistant varieties. Blue jasmine leaf tobacco (N.plumbaginifolia) is a wild tobacco species that has strong resistance to black shank in the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 党江波尚维郭启高梁国鲁张艳杨超
Owner SOUTHWEST UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com