Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving features of nano-crystalline cellulose by using glycosyl transferase promoter to drive GA20ox

A technology of nanocellulose and glycosyltransferase, which is applied in the field of genetic engineering to achieve great economic value, wide application prospects, and the effect of improving the characteristics of nanocellulose

Inactive Publication Date: 2018-11-13
INST OF FORESTRY CHINESE ACAD OF FORESTRY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are no studies on how GA20ox genes affect wood component structure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving features of nano-crystalline cellulose by using glycosyl transferase promoter to drive GA20ox
  • Method for improving features of nano-crystalline cellulose by using glycosyl transferase promoter to drive GA20ox
  • Method for improving features of nano-crystalline cellulose by using glycosyl transferase promoter to drive GA20ox

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] In order to further illustrate the method of utilizing the glycosyltransferase 8D1 promoter of the present invention to drive GA20ox to improve the characteristics of nanocellulose, the specific method and data description of 8D1P:GA20ox transgenic 84K poplar by genetic engineering are as follows:

[0060] The drugs involved in the test in Example 1 were all purchased from Sigma Company, Fermentas Company, ThermoFisher Company, and Shanghai Sangong Company.

[0061] Molecular Cloning of GA20ox Gene

[0062] 1. Extract the total RNA from the stem of Arabidopsis thaliana, amplify the full-length cDNA of the GA20ox gene by RT-PCR technology, and sequence it. See SEQ ID No.1 for the sequence. Amplification conditions were: 95°C for 5min pre-denaturation; 94°C for 30s, 55°C for 40s, 72°C for 1min, completing 35 cycles; and 72°C for 8min for fragment extension. The amplification primers are:

[0063] ArGA2OF: TGCAGGATCC ATGGCCGTAAGTTTCGTAAC

[0064] ArGA2OR:TGCAGAGCTCTTAGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for improving features of nano-crystalline cellulose by using a glycosyl transferase 8D1 promoter to drive a GA20ox. The method comprises the following steps: using the glycosyl transferase 8D1 promoter of the xylem specific expression to drive the gibberellin oxidase GA20ox gene to excessively express and change the features of the aspen wood nano-crystalline cellulose; through acquiring a recombinant vector excessively expressed by the GA20ox gene driven by the promoter 8D1P specifically expressed in the aspen stalk xylem, enabling the recombinant vector tobe used for genetic transformation of an aspen, to obtain the 8D1P:GA20ox transgene 84K aspen, and achieving a purpose of improving the features of the wood nano-crystalline cellulose. The improvementof the features of the wood nano-crystalline cellulose of the transgene aspen is that a diameter of the nano-crystalline cellulose is increased, and a draw ratio of the nano-crystalline cellulose isincreased. A fiber diameter of the nano-crystalline cellulose of a transgene material is larger, the mechanical strength of fibers can be remarkably improved, and the above feature change is more beneficial to applications of pulping and papermaking.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for improving the properties of nanocellulose by using a glycosyltransferase 8D1 promoter to drive GA20ox. Background technique [0002] Poplar is one of the important afforestation tree species widely cultivated in the world. It has the characteristics of wide distribution, fast growth, strong asexual reproduction ability, etc., coupled with its advantages of fast growth and high yield, clear genetic background, etc., and has been widely used as a research base for woody plant genetics. pattern system. my country is rich in poplar resources. In recent years, the area of ​​poplar afforestation in my country has continued to expand, and it has become the country with the largest planted forest area in the world. Populus silver gland clone 84K grows fast at emergence, is easy to transform, and has good wood quality. If the characteristics of poplar wood nanocellulose ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/53A01H5/00A01H4/00
CPCA01H4/00C12N9/0071C12N15/8246C12Y114/11013
Inventor 彭霄鹏李全梓文甲龙王晨璨许辰
Owner INST OF FORESTRY CHINESE ACAD OF FORESTRY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com