Preparation method of PAMAM and CRISPR/Cas9 system recombinant plasmid delivering nanoparticles

A technology of recombinant plasmids and plasmids, which is applied in the biological field to achieve the effect of improving tumor targeting and improving bioavailability

Inactive Publication Date: 2018-11-23
FUZHOU UNIV
View PDF2 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Retrieval of relevant literature and patents at home and abroad shows that: Apt-PAMAM / EGFR-sgRNA / Cas9 nanocomplex with tumor targeting and its preparation method have not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of PAMAM and CRISPR/Cas9 system recombinant plasmid delivering nanoparticles
  • Preparation method of PAMAM and CRISPR/Cas9 system recombinant plasmid delivering nanoparticles
  • Preparation method of PAMAM and CRISPR/Cas9 system recombinant plasmid delivering nanoparticles

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Preparation of Apt-PAMAM conjugates

[0038] First, accurately weigh 15mg of G1 PAMAM into a 20mL round bottom flask, then weigh 6mg of EDC and 4.5mg of NHS, then take 5mL of secondary water and add it to the round bottom beaker to dissolve it completely, then add 100μL of The anti-EpCAM aptamer (10mM) was reacted for 4 h, and then the unreacted PAMAM was removed by using a 10Kd ultrafiltration tube to obtain the Apt-PAMAM conjugate. The grafted amount of anti-EpCAM per mg of PAMAM nanocarrier was calculated to be 0.1nmol by Apt-modified FITC fluorescence calibration.

Embodiment 2

[0039] Example 2 Design and verification of EGFR-sgRNA

[0040] (1) Design of sgRNA

[0041] According to the selected EGFR gene and human species, search its entire gene sequence in pubmed, and search its CDS (Coding sequence) coding region sequence, and copy the CDS sequence every 250 bases to http: / / crispr The .mit.edu / website is used to design sgRNAs. According to the design results, the design results score above 90 points will be selected first, and the rationality of the design will be verified in the whole gene.

[0042] Design sgRNA as TGAACCGCACGGCGCCATGC ,

[0043] Synthesize the designed sgRNA and its complementary sequence, and add enzyme cutting sites at the beginning and end. The synthetic sequence is: EGFR-sgRNA-F: CACCGTGAACCGCACGGCGCCATGC;

[0044] EGFR-sgRNA-R: AAACGCATGGCGCCGTGCGGTTCAC.

[0045] (2) Verification of sgRNA

[0046] Anneal the sgRNA designed in (1). Add each of the above tubes into the PCR tube in the order shown in the table below, th...

Embodiment 3

[0049] Example 3 Construction of EGFR-sgRNA / Cas9 recombinant plasmid

[0050] (1) Digestion of Px459 plasmid:

[0051] According to the ingredients and amounts in Table 2, mix the above and centrifuge at low speed. After reacting at 37°C for 15 minutes, take 3 μL of the undigested plasmid and use 1% agarose gel electrophoresis for detection.

[0052] Table 2 enzyme digestion system

[0053]

[0054] (2) Preparation of recombinant plasmid: Ligation of sgRNA and plasmid after enzyme digestion

[0055] According to the ingredients and amounts in Table 3, mix the above and centrifuge at low speed. 16°C water bath overnight, and then stored in a 4°C refrigerator.

[0056] Table 3 Ligation reaction system

[0057]

[0058] (3) Transformation of plasmid

[0059] Add 50 μL of competent cells to a 1.5 μL centrifuge tube, then gently add 3 μL of the recombinant plasmid and mix well, and place in ice bath for 30 min; in a water bath at 42 °C, after 45 seconds, place on ice for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of PAMAM and CRISPR / Cas9 system recombinant plasmid delivering nanoparticles with tumor targeting. Firstly, Apt carboxyl is activated, Apt is reacted withamino on the surface of PAMAM to synthesize an Apt-PAMAM carrier, sgRNA is designed, an EGFR-sgRNA / Cas9 recombiant plasmid is constructed, and the recombiant plasmid and the carrier form an Apt-PAMAM / EGFR-sgRNA / Cas9 nano compound through electrostatic interaction. According to the compound, by means of compound surface-modified Apt active targeting tumor cell surface high expression EpCAM protein,tumor tissue targeting is improved; through a CRISPR / Cas9 gene editing technology, the recombiant plasmid of an EGFR-sgRNA gene is designed to knock out a high-expression EGFR gene in a tumor cell, so that the anti-tumor effect is achieved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for preparing a tumor-targeting nanocomplex Apt-PAMAM / EGFR-sgRNA / Cas9. Background technique [0002] According to the third national retrospective sample survey report on causes of death issued by the Ministry of Health and the Ministry of Science and Technology, lung cancer has leapt to the first place in the cause of cancer death among Chinese residents, and it is the malignant tumor with the fastest rising rate of death rate and the largest growth rate in my country. Lung cancer is divided into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), of which NSCLC accounts for 80-85% of all lung cancers, and the overexpression of epidermal growth factor receptor (EGFR) is the main reason for the unlimited proliferation of lung cancer cells One of (Moschini I, Dell'Anna C, Losardo PL, Bordi P, D'Abbiero N, Tiseo M. Radiotherapy of non-small-cell lung cancer in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K31/7105A61K48/00A61K47/34A61P35/00C12N15/90C12N9/22
CPCA61K31/7105A61K47/34A61P35/00C12N9/22C12N15/907
Inventor邵敬伟江佳丽张冰晨
OwnerFUZHOU UNIV