Genes regulating organ development in Orchid chinensis and their encoded proteins and their application

A technology for regulating genes and regulating proteins, which can be used in applications, genetic engineering, plant genetic improvement, etc., and can solve the problems of long cycle and unpredictable traits.

Active Publication Date: 2021-09-10
ENVIRONMENTAL HORTICULTURE RES INST OF GUANGDONG ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the problems of long cycle and unpredictable traits in traditional Chinese orchid hybrid breeding. By using the latest molecular biological means, the present invention excavates the genetic resources that can be applied to the improvement of plant flower type, and realizes the plant flower petal type. trait improvement

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genes regulating organ development in Orchid chinensis and their encoded proteins and their application
  • Genes regulating organ development in Orchid chinensis and their encoded proteins and their application
  • Genes regulating organ development in Orchid chinensis and their encoded proteins and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1 Cloning and sequence analysis of CsAP3 gene

[0018] 1. RNA extraction

[0019] 2 g of the organ tissue of the cultivar Damo flower was taken, and its total RNA was extracted with plant Trizol (Invitrogen) reagent and reverse transcribed into cDNA (Thermo Scientific Revert Aid First Strand cDNA Synthesis Kit).

[0020] 2. Acquisition of the target gene CsAP3

[0021] Using CsAP3-F1: ATGGGGAGAGGGAAGATAGAGAT (SEQ ID NO: 3) and CsAP3-R1: TCAAGCGAGACGCAGATCAT (SEQ ID NO: 4) as primers, using the cDNA obtained in the above step 1 as a template, using Ex-Taq enzyme (TaKaRa Biotechnology Co.) PCR, according to the following conditions: 94°C for 4 min, then 34 cycles (94°C for 40s, 59.5°C for 40s, 72°C for 1.5min, 72°C for 10min). The PCR product was recovered from the agarose gel, then ligated to the pMD19-T vector (TaKaRa Biotechnology Co.) and sent to BGI for sequencing. Analysis of the sequencing results showed that the amplified fragment contained the complete...

Embodiment 2

[0025] Example 2 Expression pattern of CsAP3 in orchids

[0026] 1. RNA extraction

[0027] Take the young leaves, old leaves, roots, pseudobulbs, different tissues of flowers, and the sepals, petals, labial petals and pistil four-wheeled flower organs of the cultivar Damo of the cultivar Damo, 2 g each, using the plant Trizol ( Invitrogen) reagent was used to extract the total RNA, and 2 μl of it was reverse transcribed into cDNA using the Thermo Scientific RevertAid First Strand cDNA Synthesis Kit.

[0028] 2. Quantitative PCR

[0029]Using primers CsAP3QRT-F: AAGGCAAGCGAGCTGACTGT (SEQ ID NO: 5) and CsAP3QR T-R: CCATCCTCTGCCTGATCTCC (SEQ ID NO: 6), the expression of CsAP3 gene in different tissues of orchids was detected by real-time quantitative PCR. Ubiquitin QRT-F: CAAAGAAGGCATTCCACCAGAT (SEQ ID NO: 7) and Ubiquitin QRT-R: CCGAGTCCCCAACTTTGTAGAA (SEQ ID NO: 8) were used as primers, and Ubiquitin was amplified as an internal reference. The following procedure was follow...

Embodiment 3

[0033] Example 3 Functional analysis of CsAP3 gene in Arabidopsis

[0034] 1. Transformation of Arabidopsis thaliana high expression vector construction

[0035] Using the primers CsAP3-F1: ATGGGGAGAGGGAAGATAGAGAT and CsAP3-R1: TCAAGCGAGACGCAGATCAT to amplify the CDs sequence of the CsAP3 gene (ie, the CsAP3 gene, the nucleotide sequence is shown in SEQ ID NO: 1), and cloned into pMD19-Tvector (Takara ), sent to BGI for sequencing. After the sequencing was correct, using EcoRI and SacI double digestion (Thermo Fisher Scientific), the purified target fragment was recovered and ligated to the pBI121 vector purified by digestion with the same two enzymes and named pBI-AP3.

[0036] 2. Transforming Arabidopsis Plants

[0037] 2.1 Transformation of Agrobacterium GV3101

[0038] 1) Thaw the competent cells stored at -80°C on ice. After the cells are completely dissolved, add about 1 μg of plasmid (pBI-AP3), mix gently, and place on ice for 30 minutes.

[0039] 2) Quick-freeze in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a Chinese orchid flower organ development regulation gene, its encoded protein and its application. The Chinese orchid flower organ development regulatory gene is isolated from the flower organ cDNA of the Chinese orchid Molan variety "Dharma" (Cymbidium sinense), and its nucleotide sequence is shown in SEQ ID NO: 1; the described The amino acid sequence of the Chinese orchid organ development regulatory protein is shown in SEQ ID NO:2. The present invention finds through genetic engineering technology that the overexpression of the Chinese orchid organ development regulation gene in Arabidopsis thaliana and orchids can change the flower shape of the plant, causing the petals to curl, and the orchid petals to transform into lips, and the properties of the lips are strengthened. Therefore, The gene and the encoded protein can be used in the research on the regulation pathway of the flower organ development of orchid plants, and in the improvement of the flower petal shape of the flowering traits of the plants.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to a Chinese orchid organ development regulation gene and its encoded protein and application. Background technique [0002] Orchids have highly specialized flower organs and rich biodiversity, and are precious horticultural ornamental flowers. More than 30,000 species of 801 genera have been found all over the world, which can be divided into three categories: ground orchids, aerial orchids and saprophytic orchids according to their ecological habits. Among them, most of the orchid species are native to China, so they are also called Guolan and are listed as one of the top ten famous flowers in China, mainly including Jianlan, Molan, Chunlan, Cymbidium, Lotus petal orchid, Douban orchid, Hanlan and Chunjian There are 8 types, with high economic value. Plant molecular biology studies have found that the B class MADS-box gene expression region expands the first ro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/02A01H6/62
CPCC07K14/415C12N15/8222C12N15/8261
Inventor 杨凤玺朱根发魏永路陆楚桥彭玲愿
Owner ENVIRONMENTAL HORTICULTURE RES INST OF GUANGDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products