Primer and probe group for detecting rs4149056 and application thereof
A primer-probe, probe technology, applied in recombinant DNA technology, microbial assay/test, biochemical equipment and methods, etc., can solve the problems of increasing statin concentration, decreasing transport function, affecting treatment effect, etc. Significant application promotion value, easy operation effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Embodiment 1, be used to detect the design of the primer probe set of rs4149056
[0051] After a lot of design, pre-experiment, and effect comparison, a set of primer probes for detecting rs4149056 was obtained.
[0052] Primer F: 5'-AAAGGAATCTGGGTCATACATGTGGA-3';
[0053] Primer R: 5'-TTAGCGAAATCATCAATGTAAGAAAG-3';
[0054] Probe P: 5'-FAM- TGC GTTCATGGGTAATATGCTTC GCA -BHQ1-3'.
[0055] Primer F is a single-stranded DNA molecule shown in Sequence 1 of the Sequence Listing. Primer R is a single-stranded DNA molecule shown in Sequence 2 of the Sequence Listing. Probe P is a single-stranded DNA molecule with a FAM fluorescent group at the 5' end and a BHQ1 fluorescent quencher group at the 3' end. The nucleotide sequence of the DNA molecule is shown in sequence 3 in the sequence table, and the underlined nucleosides Acids (i.e., positions 1, 2, 3, 24, 25, and 26) are locked nucleic acids (LNA).
[0056] The target sequences of primer F and primer R are shown in ...
Embodiment 2
[0057] Embodiment 2, the application of the primer probe set for detecting rs4149056
[0058] 1. Blood sample processing (processing method for a single blood sample)
[0059] 1. Take 65 μL of EDTA anticoagulant blood, add 500 μL of lysate, mix by inversion, centrifuge at 12000 rpm for 4 min, and discard the supernatant.
[0060] Lysis solution: 1.7g / 100ml NaCl aqueous solution.
[0061] 2. After completing step 1, add 120 μL of preservation solution, bathe in water at 65°C for 10 minutes, then in water at 85°C for 10 minutes, then centrifuge at 12,000 rpm for 4 minutes, and store at 4°C for later use. Take the supernatant before use, which is the template sample.
[0062] The preparation method of the preservation solution: ① mix 25 parts by volume of FG buffer solution and 4 parts by volume of proteinase K solution to obtain a mixed solution; ② mix 1 part by volume of the mixed solution obtained in step ① with 5 parts by volume of ddH 2 O mixed to obtain a preservation sol...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



