Designing and detecting method and application of SNP (single nucleotide polymorphism)-type non-competitive probes

A design method, a non-competitive technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of detection failure, detection effect depends on the stability of internal reference genes, time-consuming and money-consuming, etc., to achieve work volume reduction effect

Active Publication Date: 2018-12-25
领航医学科技(深圳)有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] There are some defects in the two detection situations mentioned above: 1. Competitive probes have high requirements for specificity, which makes it difficult to develop competitive probes, often requires a lot of screening work, and then consumes a lot of time. time and money
2. For the detection of gene site mutations, if the internal reference gene of a certain sample is abnormal in the method adopted by the digital PCR platform, the mutation rate detection error will be caused, which will lead to the detection failure. In this case, the detection effect depends on the internal reference gene stability
In addition, the combination of two pairs of primers and two pairs of probes also greatly increases the intensity of detection work

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Designing and detecting method and application of SNP (single nucleotide polymorphism)-type non-competitive probes
  • Designing and detecting method and application of SNP (single nucleotide polymorphism)-type non-competitive probes
  • Designing and detecting method and application of SNP (single nucleotide polymorphism)-type non-competitive probes

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment 1

[0039] Take the detection of MTHFR gene 677 as an example. MTHFR (methylenetetrahydrofolate reductase) is one of the key enzymes of homocysteine. There are three types of genotypes at 677: wild-type CC / hybrid Synzygous mutant CT / homozygous mutant TT.

[0040] The action of MTHFR metabolizes and removes homocysteine, a toxic amino acid that damages the cell wall of the endothelium. The clinical significance of detecting the MTHFR gene 677 site is as follows: look for possible hereditary thrombosis tendency, supplement folic acid, vitamin B6 and B12, and avoid recurrent miscarriage and thrombosis.

[0041] The selected samples come from: oral exfoliated cells, wherein the oral exfoliated cells are selected from the general population, and one side of the oral cavity is swabbed 20 times with a cotton swab;

[0042] DNA extraction: Use the Tiangen Biochemical DNA Extraction Kit to extract the genomic DNA of the cells, and strictly follow the instructions of the kit to extract the g...

specific Embodiment 2

[0072] It is illustrated by detecting the SNP site of the male AMELY gene homologous to the female AMELX gene. There are two genotypes at this site: male genotype CT and female genotype CC.

[0073] The selected samples come from: oral exfoliated cells, wherein the oral exfoliated cells are selected from company employees, and one side of the oral cavity is swabbed 20 times with a cotton swab;

[0074] DNA extraction: Use the Tiangen Biochemical DNA Extraction Kit to extract the genomic DNA of the cells, and strictly follow the instructions of the kit to extract the genomic DNA;

[0075] The position and flanking sequence of the SNP site to be detected in the reference genome (the reference genome version is hμManGRCh38 / hg38, see Table 6 below:

[0076] Table 6

[0077]

[0078] The corresponding primer probe sequences are shown in Table 7:

[0079] Table 7:

[0080] Numbering

base sequence

Remark

SEQ 5

GGATGGCTGCACCACCAAATC

XY Chromosome ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a designing and detecting method and application of SNP (single nucleotide polymorphism)-type non-competitive probes. The designing method of the non-competitive probes is usedto design a primer probe combination of a corresponding SNP site to be detected, one probe is used to correspondingly detect gene fragment containing a target site while the other probe is used to detect gene fragment not containing the target site, SNP genotypes are directly obtained by the fluorescence ratio of the two probes, conventional competitive SNP detection is transformed into non-competitive SNP detection, and workload in screening is greatly reduced.

Description

technical field [0001] The invention relates to the field of biological gene detection, in particular to a non-competitive probe design method, detection method and application for SNP typing. Background technique [0002] SNP--Single Nucleotide Polymorphism, that is, single nucleotide polymorphism, is a nucleotide polymorphism caused by a change in a single nucleotide base. Generally speaking, common SNP sites have two alleles, and there is one SNP polymorphic site for every 1000 bases on average in the human genome. The SNP site will affect the function of the gene, resulting in changes in the traits of organisms, and even lead to genetic diseases in severe cases. Therefore, the current research on single nucleotide polymorphism has been highly valued by many fields such as pharmacogenomics, diagnostics and biomedical research. [0003] At present, the methods for SNP detection mainly include TaqMan probe method, molecular beacon method, SCORPION probe method, SUNRISE pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6858C12Q1/686
CPCC12Q1/6858C12Q1/686C12Q2563/159
Inventor朱海涛
Owner领航医学科技(深圳)有限公司