Nucleic acid aptamer specifically recognizing neuronecrosis virus derived from pompano ovata and its application

A nucleic acid aptamer and nucleotide sequence technology, which is applied in the measurement/inspection of microorganisms, instruments, library creation, etc., can solve the problems of detection and diagnosis of nerve necrosis virus derived from oval pomfret, and achieve good application Prospect, high affinity and specificity, reproducible effect

Active Publication Date: 2021-07-23
GUANGXI ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention aims to provide a highly specific, highly sensitive, non-immunogenic, stable, easy-to-modify, easy-to-synthesize and preserve ssDNA nucleic acid aptamer for detecting neuronecrosis virus derived from pompano pomfret, to at least solve the current problem The problem that some biological detection techniques cannot quickly and accurately detect and diagnose the neuronecrosis virus of pomfret ovata on the spot

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer specifically recognizing neuronecrosis virus derived from pompano ovata and its application
  • Nucleic acid aptamer specifically recognizing neuronecrosis virus derived from pompano ovata and its application
  • Nucleic acid aptamer specifically recognizing neuronecrosis virus derived from pompano ovata and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The preparation method of embodiment 1 ssDNA nucleic acid aptamer is as follows:

[0037] Step 1: Synthesize the single-stranded DNA library and primers shown in the following sequences:

[0038] Random library Library50:

[0039] 5'-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT

[0040] 5' primer: 5'-FAM-GTCTGAAGTAGACGCAGGAG-3';

[0041] 3' Primer: 5'-Biotin-ACGCTTACTCAGGTGTGACT-3';

[0042] Step 2: Dissolve 10 nmol of the above random library in 500 μl PBS, place in a constant temperature water bath at 92°C for 5 minutes, then quickly ice-bath for 10 minutes, take the treated random library and incubate GTONNV-infected cells on ice for 1 hour; wait for incubation After the combination is completed, centrifuge and remove the supernatant, take 10mL of PBS to wash the GTONNV infected cells, and in a constant temperature water bath at 92°C for 10min, centrifuge at 12000g for 1-20min, and collect the supernatant, which is ssDNA nucleic acid aptamer library for specific...

Embodiment 2

[0055] Example 2 The preparation method of ssDNA nucleic acid aptamer is as follows:

[0056] Step 1: Synthesize the single-stranded DNA library and primers shown in the following sequences:

[0057] Random library Library50:

[0058] 5'-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT

[0059] 5' primer: 5'-FAM-GTCTGAAGTAGACGCAGGAG-3';

[0060] 3' Primer: 5'-Biotin-ACGCTTACTCAGGTGTGACT-3';

[0061] Step 2: Dissolve 10 nmol of the above random library in 500 μl PBS, place in a constant temperature water bath at 92°C for 5 minutes, then quickly ice-bath for 10 minutes, take the treated random library and incubate GTONNV-infected cells on ice for 1 hour; wait for incubation After the combination is completed, centrifuge and remove the supernatant, take 10mL of PBS to wash the GTONNV infected cells, and in a constant temperature water bath at 92°C for 10min, centrifuge at 12000g for 1-20min, and collect the supernatant, which is ssDNA nucleic acid aptamer library for specificall...

Embodiment 3

[0086] The secondary structure of the nucleic acid aptamer was predicted online by MFOLD software.

[0087] The secondary structure prediction results of the nucleic acid aptamer of SEQ ID NO:1 are as follows image 3 As shown, the nucleic acid aptamer forms a special stem-loop structure and hairpin structure.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a ssDNA nucleic acid aptamer capable of specifically recognizing cells infected with neuronecrosis virus of pompano pomfret origin and its application. The nucleotide sequence of the ssDNA nucleic acid aptamer is 5'-GTCTGAAGTAGACGCAGGAGCCTTTCGTGTTTCATTAGTGTGTTTCCATTGGGCGGCTCGGGGCAAAAGGAGTCACACCTGAGTAAGCGT‑3 ' (SEQ ID NO: 1) or 5'-CCTTTCGTGTTTCATTAGTGTGTTTCCATTGGGCGGCTCGGGGCAAAAGG-3' (SEQ ID NO: 2). The ssDNA nucleic acid aptamer of the present invention has specificity and high sensitivity to cells infected with neuronecrosis virus derived from pompano pomfret and has no immunogenicity. The ssDNA nucleic acid aptamer has high specificity, high affinity, no cytotoxicity, is stable and easy to modify, and is convenient for synthesis and storage, and can quickly and accurately detect and diagnose cells infected with neuronecrosis virus from pomfret ovata.

Description

technical field [0001] The present invention relates to a ssDNA nucleic acid aptamer and its screening method, detection method and application, in particular to a nucleic acid aptamer capable of specifically recognizing cells infected with neuronecrosis virus from pompano pomfret and its application. Background technique [0002] As a large aquaculture country, my country's aquaculture production accounts for 70% of the world's total aquaculture production. Guangxi is a large aquaculture province in my country, and the main cultured species include pomfret trevally, grass carp, channel catfish, grouper, prawns, oysters, pearl oyster and various edible plants. However, with the acceleration of urbanization, industrialization, and large-scale farming, the aquaculture environment in Guangxi is deteriorating day by day, and various diseases frequently break out, causing huge economic losses. In 2017, the viral neuronecrosis fish disease of pomfret ovata in offshore cage cultur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/115C12Q1/6806C40B50/06G01N33/569
CPCC12N15/115C12N2310/16C12Q1/6806C40B50/06G01N33/56983C12Q2531/113
Inventor李鹏飞余庆刘明珠李菲吴思婷肖贺贺
OwnerGUANGXI ACAD OF SCI