Primer, probe, kit and method for detecting transgenic soybean MON89788

A technology of MON89788 and transgenic soybean, applied in the field of molecular biology, can solve the problems such as the detection method and kit for detecting transgenic soybean MON89788, etc., and achieve the effect of simple operation and strong specificity

Inactive Publication Date: 2019-01-04
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no detection method and kit for the detection of genetically modified soybean MON89788 using the RPA method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe, kit and method for detecting transgenic soybean MON89788
  • Primer, probe, kit and method for detecting transgenic soybean MON89788

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Design and screening of primers and probes for detection of transgenic soybean MON89788RPA

[0031] The target region detected by MON89788RPA in the present invention is the transformant-specific sequence of MON89788, that is, the sequence of the junction region between the exogenous insert and the soybean genome. The forward and reverse primers are located on both sides of the junction, and the probe covers the connect area.

[0032] (1) Primer design

[0033] 5 primers were respectively designed on both sides of the connection point, and the length of the primers was 30-32bp. The sequences of the screening primers of the present invention are as follows:

[0034] F1: GTTTTCCATACTTGATTTGTCCCTTGGCT;

[0035] F2: TCTAAGTTTGAGCTCGTTACTGCTGCCCCAC;

[0036] F3: CCTCGAAACTTGTTCCTGTCCCACTCTTCCT;

[0037] F4: TTGTTCCTGTCCCACTCTTCCTTTTTGGGCTT;

[0038] F5: CTTCCTTTGGGCTTTTTTGTTTCCCGCTCT;

[0039] R1: TACCCTGACCTTGTTGAGGCTTTGGACTGA;

[0040] R2: GAATTAGCTTCCACTC...

Embodiment 2

[0049] The optimization of embodiment 2 RPA reaction system

[0050] (1) Determination of amplification temperature

[0051] Under the condition that other amplification conditions of RPA are the same, carry out RPA amplification in the temperature range of 30-45°C, determine the optimal amplification temperature of RPA according to the strength of the fluorescence signal intensity at different temperatures, and finally determine the optimal amplification The temperature was 39°C.

[0052] (2) Determine the concentration of primers and probes

[0053] Primers and probes were prepared at the same concentration, 10 μmol / L, and other amplification conditions of RPA were the same. Amplification was performed at the optimum amplification temperature of 39°C, and primers and probe combinations with different concentrations were amplified. The strength of the fluorescent signal intensity under the combination determines the optimal primer and probe concentration of RPA, and finally...

Embodiment 3

[0054] Example 3 The establishment of the kit and its detection method

[0055] The RPA detection kit of transgenic soybean MON89788 was prepared according to the following formula, and the specification of each kit was 50 reactions:

[0056] (1) Detection primer and probe solution: Synthesize forward primer F, reverse primer R and probe P, and prepare the dry powder of primer and probe with sterilized deionized water or ultrapure water with a concentration of 10 μmol / L respectively. Mother liquor, wherein the primer sequences are:

[0057] Forward primer F: CTTCCTTTTGGGCTTTTTTGTTTCCCGCTCT (SEQ ID NO: 1);

[0058] Reverse primer R: GAGCTTGATGGGGATCAGATTGTCGTTTCC

[0059] (SEQ ID NO: 2);

[0060] Probe P: CGCTTCAATCGTGGTTATCAAGCTCCAAACAC[FAM-dT][THF]A[BHQ1-dT]AGTTTAAACTGAAGGC-C3Spacer (SEQ ID NO: 3).

[0061] (2) BufferA (1.5mL): containing 50mmol / L Tris-HCl, pH 8.4, 80mmol / L KAc, 2mmol / LDTT, 3mmol / L ATP, 200μmol / L dNTPs, 20mmol / L C 4 h 10 N 3 o 5 P, 100ng / μL creatine k...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a probe, a kit and a method for detecting transgenic soybean MON89788. A primer set consists of two specific primers, the nucleotide sequence of the primer set is shown in SEQ ID No:1-2, and the probe sequence is shown in SEQ ID No.3. The detection kit comprises a detection primer, a probe solution, Buffer A, Buffer B and a positive control. The detection method adopts a specific primer and a probe to amplify a sample DNA template at 37-42 DEG C under the action of recombinase, single-stranded DNA binding protein (SSB), strand displacement DNA polymerase and nucleic acid exonuclease, and judges whether the sample contains a transgenic soybean MON89788 component through a probe fluorescence signal collection method. The method provided by the invention doesnot need special instruments, has the characteristics of high speed and efficiency, simple and convenient operation, high sensitivity, strong specificity and the like, and is suitable for on-site detection.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, relates to a detection method for transgenic plants and products thereof, in particular to a combination of primers and probes for rapid detection of transgenic soybean MON89788 using recombinase polymerase amplification technology (Recombinase Polymerase Amplification, RPA), Kits and assay methods. Background technique [0002] In 2016, the global planting area of ​​genetically modified crops reached 185.1 million hectares, an increase of more than 100 times compared with the initial commercialization in 1996. At present, the commercially grown transgenic crops mainly include soybean, corn, cotton, and rapeseed. Among them, transgenic soybean has the largest planting area in the world, reaching 91.4 million hectares in 2016, accounting for 50% of the total global transgenic crop area. Genetically modified soybean MON89788 is a herbicide-resistant genetically modified soybean developed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6844C12Q1/6895C12N15/11
CPCC12Q1/6844C12Q1/6895C12Q2521/507C12Q2531/119C12Q2537/1376C12Q2563/107C12Q2522/101
Inventor汪小福陈笑芸徐俊锋彭城徐晓丽魏巍
OwnerZHEJIANG ACADEMY OF AGRICULTURE SCIENCES