Nucleic acid aptamer and application thereof to detect pathogenic vibrio alginolyticus

Abstract

The invention discloses an ssDNA nucleic acid aptamer and application thereof to detect pathogenic vibrio alginolyticus. The nucleotide sequence of the ssDNA nucleic acid aptamer is 5'-GACGCTTACTCAGGTGTGACTCGCGTTTTATTGGTGTGGGGCTGGGGCGGTGGGTGGCTCTACTGGTTCCGTTCGAAGGACGCAGATGAAGTCTC-3'(SEQ ID NO:1). The ssDNA nucleic acid aptamer is specific for and highly sensitive to the trachinotus ovatus source pathogenic vibrio alginolyticus, and has no immunogenicity. The ssDNA nucleic acid aptamer is stable in structure and easy to modify, facilitates synthesis and preservation, and can rapidly and accurately detect and diagnose the trachinotus ovatus source pathogenic vibrio alginolyticus.

Description

technical field

[0001] The invention relates to an ssDNA nucleic acid aptamer and its screening method, detection method and application, in particular to an ssDNA nucleic acid aptamer and its application in detecting pathogenic Vibrio alginolyticus. Background technique

[0002] As a big country in aquaculture, my country's aquaculture volume accounts for 70% of the world's total aquatic product farming. However, the outbreak and prevalence of bacterial pathogens in recent years have caused huge economic losses to the aquaculture industry in my country. In Guangxi and other coastal areas of South China, Vibrio alginolyticus is one of the main pathogenic bacteria that cause bacterial fish diseases in seawater cultured fish. The fish diseases caused by it have rapid onset, high mortality and wide prevalence. Aquaculture development is seriously threatened. At present, the diagnosis of fish bacterial diseases in the world mainly adopts traditional observation methods, immuno...

Examples

Embodiment 1

[0035] The preparation method of embodiment 1ssDNA nucleic acid aptamer is as follows:

[0036] Step 1: Synthesize a random ssDNA library and primers shown in the sequence below

[0037] Random library Library50:

[0038] 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC;

[0039] 5' primer: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3';

[0040] 3' primer: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3';

[0041]Step 2: Dissolve 10 nmol of the above random library in 500 μl PBS, place in a constant temperature water bath at 92°C for 5 minutes, then quickly insert it into ice, and place it in an ice bath for 10 minutes, and incubate the treated random library with Vibrio alginolyticus live bacteria on ice for 1 hour; incubate After the binding is completed, remove the supernatant by centrifugation, wash the Vibrio alginolyticus live bacteria with 10mL of PBS, bathe in a constant temperature water bath at 92°C for 10 minutes, and collect the supernatant by centrifugation at 12000g, which is the...

Embodiment 2

[0068] According to the steps of Example 1, a rapid detection method (AFMP) for pathogenic Vibrio alginolyticus derived from pompano ovata based on the nucleic acid aptamer of SEQ ID NO: 1 was constructed and 4 different strains of Vibrio alginolyticus were detected.

[0069] Such as image 3 As shown, the above-mentioned rapid detection method (AFMP) can specifically identify four different strains of Vibrio alginolyticus (TOQZ01, TOQZ02, TOQZ03, TOQZ04), but no obvious identification of Vibrio harveyi in the control group occurred.

Embodiment 3

[0071] The secondary structure of the nucleic acid aptamer was predicted online by MFOLD software.

[0072] The secondary structure prediction results of the nucleic acid aptamer of SEQ ID NO: 1 are as follows Figure 4 As shown, the nucleic acid aptamer forms a special stem-loop structure and hairpin structure.

technical field

[0001] The invention relates to an ssDNA nucleic acid aptamer and its screening method, detection method and application, in particular to an ssDNA nucleic acid aptamer and its application in detecting pathogenic Vibrio alginolyticus. Background technique

[0002] As a big country in aquaculture, my country's aquaculture volume accounts for 70% of the world's total aquatic product farming. However, the outbreak and prevalence of bacterial pathogens in recent years have caused huge economic losses to the aquaculture industry in my country. In Guangxi and other coastal areas of South China, Vibrio alginolyticus is one of the main pathogenic bacteria that cause bacterial fish diseases in seawater cultured fish. The fish diseases caused by it have rapid onset, high mortality and wide prevalence. Aquaculture development is seriously threatened. At present, the diagnosis of fish bacterial diseases in the world mainly adopts traditional observation methods, immuno...

Examples

Embodiment 1

[0035] The preparation method of embodiment 1ssDNA nucleic acid aptamer is as follows:

[0036] Step 1: Synthesize a random ssDNA library and primers shown in the sequence below

[0037] Random library Library50:

[0038] 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC;

[0039] 5' primer: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3';

[0040] 3' primer: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3';

[0041]Step 2: Dissolve 10 nmol of the above random library in 500 μl PBS, place in a constant temperature water bath at 92°C for 5 minutes, then quickly insert it into ice, and place it in an ice bath for 10 minutes, and incubate the treated random library with Vibrio alginolyticus live bacteria on ice for 1 hour; incubate After the binding is completed, remove the supernatant by centrifugation, wash the Vibrio alginolyticus live bacteria with 10mL of PBS, bathe in a constant temperature water bath at 92°C for 10 minutes, and collect the supernatant by centrifugation at 12000g, which is the...

Embodiment 2

[0068] According to the steps of Example 1, a rapid detection method (AFMP) for pathogenic Vibrio alginolyticus derived from pompano ovata based on the nucleic acid aptamer of SEQ ID NO: 1 was constructed and 4 different strains of Vibrio alginolyticus were detected.

[0069] Such as image 3 As shown, the above-mentioned rapid detection method (AFMP) can specifically identify four different strains of Vibrio alginolyticus (TOQZ01, TOQZ02, TOQZ03, TOQZ04), but no obvious identification of Vibrio harveyi in the control group occurred.

Embodiment 3

[0071] The secondary structure of the nucleic acid aptamer was predicted online by MFOLD software.

[0072] The secondary structure prediction results of the nucleic acid aptamer of SEQ ID NO: 1 are as follows Figure 4 As shown, the nucleic acid aptamer forms a special stem-loop structure and hairpin structure.

Images