Application of keratinase gene of radiation-resistant gobi dysplasia coccus

A protease, gene technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problem of not being able to play the role of enzyme activity, limiting the scope of use of alkaline protease, etc.

Active Publication Date: 2019-01-11
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Low temperature conditions often can not play the role of enzyme activity
These conditions limit the use range of alkaline protease, and people need to find alkaline protease with wider pH range and temperature range for actual production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of keratinase gene of radiation-resistant gobi dysplasia coccus
  • Application of keratinase gene of radiation-resistant gobi dysplasia coccus
  • Application of keratinase gene of radiation-resistant gobi dysplasia coccus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Expression of Deinococcus Gobi KerA Gene Sequence in Escherichia coli

[0031] 1. Experimental materials

[0032] Escherichia coli BL21(DE3): It is a commercial product of Beijing Quanshijin Company.

[0033] PCR Template DNA: Deinococcus Gobi Genomic DNA

[0034] 2. Experimental method

[0035] 1. Design 1 pair of PCR-specific primers according to the KerA gene sequence in the published Deinococcus gobi genome:

[0036] KerA-F: 5′ACCGGATCCGATGAACGGACGTCTTACCCT 3′

[0037] KerA-R: 5′ACCCTCGAGGAAGTTCAGGGTGTACAGCA 3′

[0038] 2. The target gene sequence was amplified from the genomic DNA of Deinococcus gobii by PCR method.

[0039] Reaction conditions: 94°C for 10 min, 35 cycles of [94°C for 30 sec, 60°C for 30 sec, 72°C for 1.5 min], 72°C for 10 min.

[0040] 3. After the PCR product was recovered by gel, it was cloned on the vector pJET, named pJET-KerA, and verified by sequencing; then the KerA gene containing sticky ends and the pET-KerA gene containin...

Embodiment 2

[0045] Example 2 Preliminary Analysis of KerA Protease Activity of Deinococcus Gobi

[0046] 1. Experimental materials

[0047] Recombinant engineering strain: the BL21-KerA strain expressing the KerA gene obtained in Example 1

[0048] Control strain: the BL21-22b strain containing the empty plasmid described in Example 1.

[0049] 2. Experimental method

[0050] 1. Plate degradation circle experiment

[0051] 1) Pick out the monoclonal strains and inoculate them in liquid LB medium containing Amp, and culture them on a constant temperature shaker at 37°C overnight

[0052] 2) Transplant the seed liquid into a new LB medium, and cultivate to the logarithmic growth phase. Prepare 1% agar plates containing 1% skim milk. Spot the strain on the plate, measure the diameter of the hydrolysis circle and the diameter of the colony every 12 hours until it is stable.

[0053] 3) Calculate the ratio H / C of the diameter of the hydrolysis circle to the diameter of the colony on the ...

Embodiment 3

[0061] Example 3 Deinococcus Gobi KerA Protease Activity Assay Experiment

[0062] 1. Experimental materials

[0063] Recombinant engineering strain: the BL21-KerA strain expressing the KerA gene obtained in Example 1

[0064] 2. Experimental method

[0065] 1. Protein expression and purification

[0066] 1) Pick out the single clone and inoculate it into 50mL liquid LB medium containing Amp, and cultivate overnight in a constant temperature shaker at 37°C

[0067] 2) Transfer 0.1% of the seed solution of the transferred strain to fresh LB medium, and culture it on a constant temperature shaker at 37°C to OD 600 up to 0.6

[0068] 3) Add IPTG with a final concentration of 1.0mM to the medium, and induce culture at 30°C for 8h

[0069] 4) Centrifuge at 12000rpm to collect the bacteria and culture supernatant, the supernatant is the crude enzyme solution

[0070] 5) Add loading buffer, boil for SDS-PAGE analysis.

[0071] 2. Protease activity assay

[0072] The enzymatic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene KerA with the function of degrading complex structural proteins, which is found from desert environment strains. The invention constructs a recombinant vector containingthe gene and expresses the recombinant vector in prokaryotic host cell Escherichia coli. Experiments show that the gene can degrade the function of complex structural proteins after being expressed in prokaryotic host cells, and can be used in protease-catalyzed biodegradation and related industrial production.

Description

technical field [0001] The invention belongs to the technical field of biodegradation, and relates to a keratinase gene of Deinococcus radiotolerant Gobi bacteria to degrade proteins with complex structures and exert the hydrolysis function of alkaline protease. Background technique [0002] Protease has a wide range of applications in feed, fabric treatment, detergent, medicine and other industries. Alkaline protease refers to a class of proteases that hydrolyze protein peptide bonds under alkaline conditions. [0003] Microbial alkaline protease is generally active in the pH range of 7-11, and the optimum pH is mostly 9.5-10.5. Most microbial alkaline proteases are not heat-resistant, and only a few strains produce alkaline proteases that can withstand high temperatures of 70°C. Low temperature conditions often can not play the role of enzyme activity. These conditions limit the use range of alkaline protease, and people need to find alkaline protease with wider pH rang...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/52C12N15/57C12N1/21C12P21/06C12R1/19
CPCC12N9/52C12P21/06
Inventor林敏王劲周正富耿秀秀张维陈明
OwnerTHE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI