Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene chip for non-invasive prenatal assessment of hemifacial microsomia, kit and application method of gene chip

A gene chip and application method technology, applied in the fields of medicine and biology, can solve problems such as mental and physical pain, and achieve the effects of reducing patient pain, shortening time, and saving cost and time

Active Publication Date: 2019-01-11
张娇
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] There is no specific prenatal detection method for the traditional hemifacial short syndrome, and it can only be treated after birth, after a long wait until the age of 5-7, which brings both mental and physical pain to the patient's family

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene chip for non-invasive prenatal assessment of hemifacial microsomia, kit and application method of gene chip
  • Gene chip for non-invasive prenatal assessment of hemifacial microsomia, kit and application method of gene chip
  • Gene chip for non-invasive prenatal assessment of hemifacial microsomia, kit and application method of gene chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] A gene chip for non-invasive prenatal assessment of hemifacial short syndrome, the gene chip includes a film base, on which a probe group for detecting genes related to hemifacial short syndrome is provided to form a microarray gene Chip; the probe set includes 13 probes, and the sequence of each probe is as follows: (1) probe P1: its nucleotide sequence is AGAGTAATGCTGTCCATTGCCCA; (2) probe P2: its nucleotide sequence is AAGATATTCACTCTCTGGCTAGGCCTA; (3) probe P3: its nucleotide sequence is ATATGAAATAAGGAGGAGATAAGAGA; (4) probe P4: its nucleotide sequence is GCTGGGATTACAGGCATGAGCCACTGT; (5) probe P5: its nucleotide sequence is AAAGAAAATATCTCAAAAGAATCAAC; (6) Probe P6: its nucleotide sequence is AAGCTCAGGGGCTCAGGAGGCAGGA; (7) probe P7: its nucleotide sequence is CTGAATCCTTGTTGGCTTCAGAGTCAG; (8) probe P8: its nucleotide sequence is CTGATCCTCTGAGGGATTGATGACA; (9) probe P9: its The nucleotide sequence is TAAAGTGGGAGGATTGCTTGAGCCC; (10) probe P10: its nucleotide sequence is ...

Embodiment 2

[0065] A method for preparing a gene chip for non-invasive prenatal evaluation of hemifacial short syndrome, in which a glass slide is selected as the carrier sheet of the gene chip, and the preparation of the gene chip then includes the following steps, in order: (1) Acid-base pretreatment of glass slides; (2) aldehyde treatment; (3) isothiocyanation treatment, (4) chip probe design; (5) probe spotting; (6) spotting completed chips Place and bake at 80°C for 10 minutes to make microarray slides; (7) Store in a box with a desiccant and store at room temperature.

[0066] In this example, the preparation method can be prepared by conventional methods, and the emphasis is on the gene chip itself rather than its preparation method.

Embodiment 3

[0068] A kit for non-invasive prenatal risk assessment of congenital hemifacial short syndrome, the kit includes the gene chip described in Example 1.

[0069] The kit also includes a primer set, the primer set is preferably 13 sets of primers, and the 13 sets of primers are as follows:

[0070] (1) Primer set 1: ①Primer F1: its nucleotide sequence is ATTCCCCTTCATCATTGTC; ②Primer R1A: its nucleotide sequence is GGTCAGCTTAGTATCCAGG; ③Primer R1: its nucleotide sequence is GGTCAGCTTAGTATCCAGA;

[0071] (2) Primer set 2: ①Primer F2: its nucleotide sequence is TGGATTCTACATTTCCTAA; ②Primer F2A: its nucleotide sequence is TGGATTTCTACATTTCCTAG; ③Primer R2: its nucleotide sequence is GGCAGTAGTGATAGGAGAA;

[0072] (3) Primer set 3: ①Primer F3: its nucleotide sequence is TTAGAAAATGGTTAAGTGT; ②Primer F3A: its nucleotide sequence is TTAGAAAATGGTTAAGTGG; ③Primer R3: its nucleotide sequence is ACTCCAGCTAGAGGTAAAT;

[0073] (4) Primer set 4: ①Primer F4: its nucleotide sequence is GACCTTAGGTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene chip for non-invasive prenatal assessment of hemifacial microsomia, a kit and an application method of the gene chip. The gene chip comprises a chip base on which a probe group is arranged to form a microarray gene chip. The kit includes the gene chip / primer set, enzyme system and the like. The application method of the gene chip comprises the following steps: firstly, preparing a sample containing DNA, then PCR amplification, and then hybridizing with the gene chip. The microarray chip can be used to detect the cf-FDNA is used as a template to carry out multiple PCR amplification, after obtaining PCR amplification product, hybridizing with the chip of the invention, and determining whether the fetus carries genes related to the congenital hemifacial microsomia according to the hybridization result; Very simple, greatly reduce the error rate and time cost, improve the accuracy; It can be used in the prenatal diagnosis of congenital hereditary diseases and has great potential in the field of non-invasive prenatal diagnosis.

Description

technical field [0001] The invention relates to the technical fields of biology and medicine, in particular to a gene chip, a kit and an application method of the gene chip for non-invasive prenatal evaluation of hemifacial short syndrome. Background technique [0002] Craniofacial microsomia (CFM) is a group of major birth defects including abnormalities of the outer and middle ears, maxillary and maxillary deformities, facial nerves, and maxillofacial soft tissue abnormalities. Worldwide, the incidence of hemifacial shortness is between 1 / 3000-1 / 5000, and the male to female ratio is about 3:2. my country is located in one of the three high-incidence regions (Central and South America, East Asia, and Northern Europe) with short hemiface. The birth defect monitoring data shows that the incidence rate of birth defects in my country is 1 / 3000 newborns, which is the second most common birth defect after cleft lip and palate. Disorders of facial deformities. Hemifacial shortnes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6837
CPCC12Q1/6837C12Q1/6883C12Q2600/16C12Q2600/166C12Q2537/143C12Q2563/107C12Q2531/113
Inventor 张娇章庆国赵驰
Owner 张娇