Unlock instant, AI-driven research and patent intelligence for your innovation.

A molecular beacon-g quadruplex optical sensor and its application in the detection of sv40 virus

An optical sensor and molecular beacon technology, applied in the field of biochemical analysis, can solve problems such as insufficient sensitivity, complex operation process, unsuitable for large-scale screening and detection at the grassroots level, and achieve good selectivity.

Active Publication Date: 2022-07-22
GUANGDONG OCEAN UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Chinese Pharmacopoeia provides a PCR detection method for the detection of SV40, but in actual work, it is found that the amplification effect is not good, and there is a high possibility of missed detection, and the PCR detection is in the whole detection process. The requirements for experimental instruments and overall laboratory facilities have high technical requirements, which are not suitable for large-scale screening and testing at the grassroots level
However, the traditional separation, culture and detection technology takes a long time to cultivate, and the operation process is relatively complicated. It needs to be operated under sterile conditions, and has relatively high requirements for the relevant professional knowledge and operation skills of the operator, which limits the application of this method in clinical and non-operative procedures. Applications in the laboratory environment
The sensitivity of immunofluorescence detection is not stable enough, and needs to be further improved and perfected

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular beacon-g quadruplex optical sensor and its application in the detection of sv40 virus
  • A molecular beacon-g quadruplex optical sensor and its application in the detection of sv40 virus
  • A molecular beacon-g quadruplex optical sensor and its application in the detection of sv40 virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Example 1 Detection of SV40 virus

[0072] (1) In 250μL of 2μmol / L molecular beacon buffer solution of PBS (20mM, pH 7.4), add 50μL of a series of different concentrations of target duplex DNA (Oligo-1 and Oligo-2) or test samples respectively , 50μL 5mmol / L arginine, 50μL 3μmol / L silver ion and 50μL 1mol / L potassium ion, at 25 ℃ for 1.5 hours;

[0073] (2) Add 50 μL of 40 μM NMM to the above solution, and incubate at 25°C for 15 minutes; that is, the final concentrations of arginine, silver ions and potassium ions in the reaction system are 0.5 mmol / L, 0.3 μmol / L and 100 mmol, respectively. / L;

[0074] Then, the mixed solution was transferred to a micro-quartz sample cell (3mm×10mm×47mm) to measure the fluorescence emission at a wavelength of 614nm; wherein, the fluorescence spectrum measurement parameters were set: excitation wavelength 399nm, slit width 5nm, emission wavelength scanning range 580 ~650nm.

[0075] The experimental schematic is as follows figure 1...

Embodiment 2

[0078] Embodiment 2 Detection of SV40 virus

[0079] (1) In 250μL of 2μmol / L molecular beacon buffer solution of PBS (20mM, pH 7.4), add 50μL of a series of different concentrations of target duplex DNA (Oligo-1 and Oligo-2) or test samples respectively , at 25°C for 1.5 hours;

[0080] (2) Add 50 μL of 40 μM NMM to the above solution, and incubate at 25°C for 15 minutes; then, transfer the mixture to a micro-quartz sample cell (3mm×10mm×47mm) to measure the fluorescence emission at a wavelength of 614nm; Spectral measurement parameter settings: excitation wavelength is 399 nm, slit width is 5 nm, and emission wavelength scanning range is 580-650 nm.

[0081] The sensor of this embodiment has the advantages of high sensitivity, good specificity and good selectivity for the detection of SV40 virus. When the concentration of SV40 virus double helix DNA sequence was in the range of 5-300 nmol / L, the fluorescence signal value increased with the increase of target strand DNA conc...

Embodiment 3

[0082] Example 3 Variation of fluorescence intensity with spermine concentration

[0083] 1. Method

[0084] On the basis of Example 1, the spermine concentration of the reaction system is used as a single factor variable, and ΔI is used as an indicator (ΔI is defined as the difference in fluorescence intensity, and the definition formula of ΔI is ΔI=I target -I blank , I target Indicates the presence of the fluorescent signal of the target strand, I blank Indicates the fluorescence signal without the addition of the target strand), to investigate the effect of different spermine concentrations on the detection effect of the SV40 virus-specific target duplex DNA sequence.

[0085] 2. Results

[0086] The experimental results are as figure 2 As shown, the change of spermine concentration significantly affects the intensity of the detected fluorescence intensity. When the spermine concentration is in the range of 0.1 to 0.5 mmol / L, the absorbance value increases with the i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular beacon-G quadruplex optical sensor and its application in detecting SV40 virus. The sensor includes a molecular beacon in a hairpin structure that includes a G-quadruplex sequence, a loop region capable of specifically binding to target double-stranded DNA, and preventing the formation of a G-quadruplex structure The stem-like region of ; the sequence of the molecular beacon is: 5'‑CCCTACCCTTTTTTCTTCTCTTTCC(T) 6 GGGTAGGGGCGGTTGGG‑3'. The invention can realize the quantitative detection of SV40 virus-specific target double helix DNA according to the change of fluorescence intensity, and plays an important role in the detection of SV40 virus. The maximum linear detection range is 5-300 nmol / L, and the detection limit is 3 nmol / L, the correlation coefficient is 0.992, and it has good selectivity and broad application prospects.

Description

technical field [0001] The invention belongs to the technical field of biochemical analysis. More specifically, it relates to a molecular beacon-G quadruplex optical sensor and its application in detecting SV40 virus. Background technique [0002] Simian Virus 40 (SV40) belongs to the family Papovaviruidae. Polyoma virus is a member of DNA tumor viruses that can induce abnormal cell proliferation or cause tumors. SV40 is a simian kidney cell virus discovered and isolated by Sweet and Hileman in 1960. It is parasitic in the human body. It is composed of structural proteins (VP1, VP2, VP3) and two antigens (LT and st). Large numbers of people have been reported to be infected with SV40 virus by using SV40-contaminated monkey kidney cells to culture polio vaccine. In addition, it can also be transmitted in the population through blood and fecal-oral routes, and the number of infections is increasing at a rate of 1.2% per year, posing a threat to human health. Foreign scholar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/6825
CPCC12Q1/6825C12Q1/701C12Q2525/301C12Q2563/107C12Q2565/607
Inventor 李宇彬龙齐英
Owner GUANGDONG OCEAN UNIVERSITY