Method for expressing and purifying novel cell reprogramming factor

A technology of cells and expression vectors, applied in the field of expression and purification of new cell reprogramming factors, which can solve the problems of reduced transmembrane activity

Inactive Publication Date: 2019-02-01
GUANGDONG MEDICAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The TAT protein is composed of 86-102 amino acids, and the fragment that maintains its membrane-penetrating activity only contains 11 amino acids. The amino acid residues at positions 47-57 have a sequence of YGRKKRRQRRR, and removing any arginine will make it Reduced transmembrane activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing and purifying novel cell reprogramming factor
  • Method for expressing and purifying novel cell reprogramming factor
  • Method for expressing and purifying novel cell reprogramming factor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Construction of pET-HisSu-TN-Oct4 fusion protein expression vector

[0027] use as figure 1 The indicated expression vector pET-3c (purchased from Novagen, USA) clones and expresses the HisSu-TN-Oct4 fusion protein of the present invention.

[0028] The pET-3c vector has multiple cloning sites. According to the restriction site of pET-3c vector and the cDNA sequence of Oct4 protein, the following primers were designed:

[0029] OctF:GC GGTACC GCTGGACACCTGGCTTCAG (SEQ ID NO.3); contains Kpn I restriction site (underlined).

[0030] OctR:GA AGATCT TCAGTTTGAATGCATGGGAGAGCCC (SEQ ID NO. 4), containing a Bgl II restriction site (underlined).

[0031] Oct4 cDNA was amplified using TetO-FUW-OSKM plasmid as a template. The PCR reaction conditions were: 1×PCR reaction buffer, 0.5 μM Oct-F, 0.5 μM Oct-R, 1 μg TetO-FUW-OSKM plasmid, 2U DNA polymerase (Fermentas), 50 μM dATP, 50 μM dTTP, 50 μM dCTP, 50μM dGTP, 1.5mM MgCl2, adjust the reaction volume to 50μl with ...

Embodiment 2

[0036] Example 2 Expression and purification of pET-HisSu-TN-Oct4 expression vector

[0037] The recombinant DNA plasmid pET-HisSu-TN-Oct4 obtained above was transformed into Escherichia coli Rossate (DE3) (purchased from Novagen, USA). The transformants of Escherichia coli Rossate (DE3) containing pET-HisSu-TN-Oct4 were inoculated in LB medium containing 50 μg / ml of ampicillin and chloramphenicol, and cultured overnight at 37°C. Inoculate into LB liquid medium (containing ampicillin and chloramphenicol) with 1% inoculum amount, and culture on a shaker at 37°C until OD 600 0.5 to 0.6. Human isopropyl-β-D-thiogalactopyranoside (IPTG for short) was added to the culture solution to a final concentration of 0.5 mM, induced at 30°C for 4 hours, and the cells were collected by centrifugation. The bacteria were resuspended in 50 mM sodium phosphate buffer (containing 300 mM NaCl, 1 mM phenylmethylsulfonyl fluoride (PMSF for short), pH 7.4). Sonicate the cell wall, centrifuge at 10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for expressing and purifying a novel cell reprogramming factor. A small ubiquitin-like modifier (SUMO) and a cell penetrating peptide (TAT) are introduced to at the 5'end of a mouse Oct4 gene by a genetic engineering technique. A large number of a TAT-Oct4 protein with a penetrating activity is obtained through in-vitro fusion expression and enzymatic digestion purification, a foundation is laid for the realization of reprogramming cells into iPS cells by using the reprogramming factor protein inducer and the final obtaining of precursor cells for platelet production; and the protein or the nucleotide sequence can be used to induce the production of the iPS cells.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a method for expressing and purifying a novel cell reprogramming factor. Background of the invention [0002] The main reprogramming transcription factors currently used in induced pluripotent stem cells (iPS) are Oct4, Sox2, Klf4, and c-Myc. These transcription factors can turn off the function of their own tissue-specific cells, while successfully activating the characteristics of pluripotent cells. The interaction between OSKM and chromatin was studied in embryonic stem cells (ESC), and it was found that Oct4, Sox2 and Klf4 preferentially bind to enhancers, and c-Myc mainly binds to promoters. [0003] The transcription factor Oct4, also known as OCT3, OCT3 / 4, OTF3, and OTF4, is encoded by the Pou5F1 gene and acts as a master regulator to maintain embryonic stem pluripotency and self-renewal capacity. Oct4 protein is located on chromosome 17, encoding 352 amino acids, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/47C12N15/85A61K38/17
CPCA61K38/00C07K14/47C12N15/85
Inventor庞实锋林灼锋庞锦锋曹定国梁朋丁银润张国平何滔
OwnerGUANGDONG MEDICAL UNIV