Application of NW_006882077-1 in CHO cell genome to stable expression of protein

A stable expression and cell gene technology, applied in the field of genes, can solve the problems of time-consuming and laborious screening of high-expression monoclonal, hinder the efficiency of recombinant cell lines, and high cost, so as to avoid high-expression monoclonal screening and overcome the uncertainty of integration sites performance and reduce development time

Active Publication Date: 2019-02-12
JIANGNAN UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The monoclonal cells obtained through random integration cannot guarantee the stable expression of polypeptides / proteins during cell passage, and repeated monoclonal screening is required for each recombinant cell construction, which increases the research and development costs of biopharmaceuticals
[0004] The site effect hinders the efficiency of traditional random integration to construct recombinant cell lines, and repeated high-expression monoclonal screening is time-consuming, laborious and expensive
How to overcome the site effect and use site-specific integration technology to quickly and efficiently obtain stable expression monoclonal cells has been discussed in academia for many years, but there has been no breakthrough.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of NW_006882077-1 in CHO cell genome to stable expression of protein
  • Application of NW_006882077-1 in CHO cell genome to stable expression of protein
  • Application of NW_006882077-1 in CHO cell genome to stable expression of protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Selection of high expression sites;

[0043] NW_006882077.1 was integrated at base 691045, where the Zsgreen1 gene was integrated. For this fluorescent cell, subculture was carried out for no less than 50 generations, and the expression level of its fluorescence was detected by flow cytometry. The 50th generation of fluorescent cells still has a good expression level of green fluorescent protein, and the fluorescent signal can be stably retained during the passage of cells.

[0044]In addition, this fluorescent cell was also subjected to suspension acclimation, and the expression level of the fluorescent protein after suspension acclimation was detected again by flow cytometry. The test results show that more than 95% of the recombinant CHO cells that have been suspended for 50 passages still maintain the expression of green fluorescent protein after suspension. It can be considered that this site is extremely stable and will not be lost due to cell passage. fluoresce...

Embodiment 2

[0046] selection of specific targets;

[0047] According to the principle of proximity, the sequence:

[0048] 5'CCAATGCTATTACCTTCTTCAGCATCTGTTCTTGAAGACCTTCAGTCACTTTAGTTAACTCTTTCCACTTTCGTTACTGCAACTCTCAGATC-TAACTTGGCTTG 3'

[0049] Input into the CRISRPRater system to predict and select target sequences with low off-target efficiency. The parameter settings are as follows: 1) The maximum number of mismatched bases in the first 15 bp after NGG is 0; 2) The number of mismatched bases in all 21 bp after NGG is 2.

[0050] After the above operation, the following sequence with a score of 0.87 was selected as the target sequence according to its score:

[0051] 5'-GATCTAACTTGGCTTGCCTGAGG-3';

[0052] According to the CRISPRater system, LOW efficacy (score0.74).

[0053] According to the CRISPRater evaluation system, all the target sequences in the range of 690980-691090 near the site NW_006880285.1 obtained a score of more than 0.56, all of which were in the moderately effective...

Embodiment 3

[0054] The selection of embodiment 3 promoter

[0055] Replace the above CMV (strong mammalian expression promoter derived from human cytomegalovirus) promoter position with different promoters, including EF-1a (strong mammalian expression promoter derived from human elongation factor 1α), SV40 (simian Mammalian expression promoter derived from vacuolar virus 40), PGK1 (mammalian promoter derived from phosphoglycerate kinase gene), UBC (mammalian promoter derived from human ubiquitin C gene), human beta actin (β- Actin gene-derived mammalian promoter) or common promoters such as CAG (strong hybrid mammalian promoter). After detection, the above promoters can all regulate the downstream red fluorescent protein gene sequence, and express the corresponding red fluorescent protein.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses application of NW_006882077-1 in CHO cell genome to stable expression of protein. The site for stably expressing protein in the CHO cell genome is at the base 691045 of the CHOcell gene NW_006882077.1; the 5'NNNNNNNNNNNNNNNNNNNNNGG3' identifiable to the CRISPR / Cas9 technology between 690980 and 691090 near the site is the target sequence. According to the application disclosed by the invention, different protein genes are imported to a fixed position in the CHO cell genome and are stably expressed.

Description

technical field [0001] The invention relates to the field of gene technology, in particular to a CHO cell recombinant gene for stably expressing protein. Background technique [0002] Chinese Hamster Ovary cell (CHO) is the main cell line in the field of biopharmaceuticals, and many different types of CHO cell lines have been developed, including cell lines that can be used to expand gene copy number. However, there is no clear positive correlation between the increase in the copy number of the transgene and the increase in the yield of the target protein. And even if the protein expression increased, the expression level of most CHO cells was unstable. The currently commonly used method for constructing stable transfected cells is time-consuming and labor-intensive, mainly because a large number of monoclonal screening processes need to be repeated. Therefore, it is generally expected in the field of cell line construction that a method that can obtain high-quality cells i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N15/85C12N5/10
CPCC12N5/0682C12N15/85C12N15/907C12N2510/02C12N2800/107C12N2810/10C12N2310/20
Inventor李华钟金坚周松涛陈蕴段作营龚笑海
OwnerJIANGNAN UNIV