A gene s1a4 controlling sterility in Asian-African rice hybrids and its application

An S1A4, gene technology, applied in the field of genetic engineering technology and crop genetics and breeding, can solve problems such as restricting the application of Asian-African rice hybridization, and achieve the effect of eliminating hybrid sterility and improving crop yield.

Active Publication Date: 2021-01-26
SOUTH CHINA AGRI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, because the mechanism of Asian-African rice interspecific hybrid sterility has not yet been ascertained, the application of Asian-African rice hybrids in elite rice varieties is severely restricted.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene s1a4 controlling sterility in Asian-African rice hybrids and its application
  • A gene s1a4 controlling sterility in Asian-African rice hybrids and its application
  • A gene s1a4 controlling sterility in Asian-African rice hybrids and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1. Functional identification of the key gene S1A4 of the S1 locus hybrid sterile gamete lethal system

[0038] The S1 gene locus of interspecific hybrid sterility in Asian-African rice is a hybrid sterility locus that simultaneously controls female and male gamete sterility, and there are 6 expressed genes in the S1-g interval ( figure 1 A), among them, S1TPR and S1A6 (SSP) are the reported hybrid sterility genes involved in the S1 locus (Xie et al. 2017; Koide et al. 2018).

[0039] 1. Transforming the S1TPR and S1A6 double-gene vectors into the parents of O. sativa

[0040] 1. Experimental method

[0041] (1) Using the primers in Table 1, the S1TPR and S1A6 genes were amplified from the African rice genome, and then the amplified fragments were cloned into the EcoRI and BamHI sites of the binary vector pCambia1300 using the Giboson assembly ligation method.

[0042] The Giboson assembly ligation method was as follows: cut 100 ng of pCambia1300 into lines wit...

Embodiment 2

[0059] Example 2. Gene knockout of S1A4 using CRISPR / Cas9 technology

[0060] 1. Experimental method

[0061] According to the nucleotide sequence of the S1A4 gene (the nucleotide sequence is shown in SEQ ID NO: 1, and the amino acid sequence encoded by it is shown in SEQ ID NO: 2), a 20bp sequence is selected in the S1A4 exon (the nucleotide sequence is shown in SEQ ID NO: 2). ID NO: 3 TGATAGAGCCCAAGAATCGG) as the S1A4 knockout target. The target linker sequence (U6a-S1A4-F / U6a-S1A4-R, nucleotide sequence shown in SEQ ID NO: 4-5) was denatured and then ligated into the sgRNA expression cassette intermediate vector pLYsgRNA-OsU6a.

[0062] Utilize the primer pair Pps-GGL / Pgs-GGR in Table 2 to amplify the expression cassette primer (nucleotide sequence shown in SEQ ID NO: 6-7), and connect it into the CRISPR / Cas9 vector. The constructed CRISPR / Cas9 vector was transformed into Agrobacterium EHA105, and introduced into the near isogenic line NIL-g containing African rice S1-g t...

Embodiment 3

[0070] Example 3 Obtaining the s1a4 mutant that does not carry the transgenic element

[0071] Using the marker of the transgenic hygromycin resistance screening gene HPT, the transgenic elements of the knockout vector (containing Cas9 gene, guide RNA / sgRNA, and hygromycin resistance gene HPT) were separated for multiple generations, and isolated without transgenic elements s1a4 mutant.

[0072] 1. Experimental method

[0073] Extract the T of s1a4 0 ,T 1 and T 2 Using the genomic DNA of the first generation as a template, use the primer pair Hpt-F / Hpt-R in Table 4 to amplify the partial sequence of the HPT gene to determine whether the transgenic element exists or not.

[0074] Table 4 Transgenic plant detection primers

[0075]

[0076] 2. Experimental results

[0077] Such as figure 2 shown, at T 0 In this generation, 10 positive transgenic plants were obtained, and then the progeny of line 1 (s1a4-1) was analyzed, and T 1 No. 3 and No. 8 lines in the progeny l...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of genetic engineering technology and crop genetic breeding, and specifically discloses a gene for controlling interspecific hybrid sterility between Asian rice and African rice S1A4 and its application. The present invention clones an interspecific hybrid sterility locus between Asian rice and African rice S1 Related African Oryza Specific Genes S1A4 , identified the cause of hybrid gamete sterility S1A4‑S1TPR - S1A6 Three-factor gamete lethal system; for African rice S1A4 The mutant line obtained by site-directed knockout has normal fertility, but the hybrid between this mutant line and O. sativa can eliminate hybrid sterility and effectively break S1 mediated interspecific hybrid fertility disorders. The invention provides knockout by means of genetic engineering S1A4 Gene, a method for efficiently creating hybrid-compatible African cultivated rice varieties (lines), provides potential application value for the use of distant heterosis to improve rice yield in molecular breeding.

Description

technical field [0001] The invention belongs to the fields of genetic engineering technology and crop genetic breeding, and specifically relates to a hybrid sterility gene S1A4 for controlling the hybridization of Asian rice and African rice and its application. Background technique [0002] Rice (Oryza) is an important source of human food crops. The cultivated rice species of rice mainly include the Asian cultivated rice (O. sativa L.) distributed in Asia and the African cultivated rice (O. glaberrima) distributed in West Africa. Asian cultivated rice is a widely planted food crop, while African cultivated rice is an important germplasm with many excellent agronomic traits such as heat resistance, drought resistance, aluminum toxicity resistance, and disease resistance. resource. There is a large genetic difference between Asian cultivated rice and African cultivated rice, and there is obvious heterosis. However, due to the genetic differentiation of these two rice spec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H1/02A01H5/00A01H6/46
CPCA01H1/02C07K14/415C12N15/8213C12N15/8287
Inventor陈乐天刘耀光谢勇尧汤金涛李小娟费越
OwnerSOUTH CHINA AGRI UNIV