Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

An adeno-associated virus that silences the expression of rasgrp1 in mouse intestinal tract and its preparation method and application

An intestinal and mouse technology, which is applied in the field of adeno-associated virus that silences the expression of RASGRP1 in the intestinal tract of mice and its preparation, and achieves a good effect of interference

Active Publication Date: 2022-03-01
SHUGUANG HOSPITAL AFFILIATED WITH SHANGHAI UNIV OF T C M
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the prior art, there is no report on the adeno-associated virus that silences the expression of RASGRP1 in the intestinal tract of mice according to the present invention

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An adeno-associated virus that silences the expression of rasgrp1 in mouse intestinal tract and its preparation method and application
  • An adeno-associated virus that silences the expression of rasgrp1 in mouse intestinal tract and its preparation method and application
  • An adeno-associated virus that silences the expression of rasgrp1 in mouse intestinal tract and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 RASGRP1 overexpression plasmid construction

[0048] Experimental process

[0049] PCR amplification target gene. The gelatin recovery carrier fragment was carried out after expression of the carrier enzyme. The purpose gene was transferred to E.COLI sensitic cells after homologous recombination of the carrier fragment. Transformants were identified by colors PCR, positive cloning sequencing. Sequencing erroneous clones perform plasmid extraction. Experimental process figure 1 Indicated.

[0050] 2. Experimental materials

[0051] Reagent name Source of reagents Cat.no. Tool carrier Freight Biological Engineering (Shanghai) Co., Ltd. / Primestar Takara DR010A TAQ enzyme and DNTP Takara DR001B Seamless cloned kit Freight Biological Engineering (Shanghai) Co., Ltd. / NHEI-HF NEB R3131L Hindiii-HF NEB R3104L DH5A sensitive state cells Takara D9057 Small tetraerator Promega A1460 Agarose gel DNA recovery k...

Embodiment 2

[0097] Example 2RASGRP1SHRNA interference vector construction (3 targets)

[0098] Experimental process

[0099] PCR amplification target gene. The gelatin recovery carrier fragment was carried out after expression of the carrier enzyme. The purpose gene was transferred to E.COLI sensitic cells after homologous recombination of the carrier fragment. Transformants were identified by colors PCR, positive cloning sequencing. Sequencing erroneous clones perform plasmid extraction.

[0100] 2. Experimental materials

[0101]

[0102]

[0103] 3. Carrier map

[0104] Carrier map such as Figure 8 Indicated.

[0105] 4. Carrier

[0106] The tool carrier is used to extract the tool carrier with BSPEI and NHEI-HF, and the 5719 bp carrier fragment is recovered. Figure 9 Indicated.

[0107] 5. SiRNA design

[0108] Viral vector construction framework:

[0109] NO. 5’ STEMP Loop STEMP 3’ PaAVE2113-1 CCGG TCGACCGACCCAAATTAATT CTCGAG Aattaattggggtcgtgtcga TTTTTTTTTTT ...

Embodiment 3

[0145] Example 3 Overgraded and interfering plants total transfection 293T cells

[0146] (1) One day before transfection, the cells paveled.

[0147] (2) 12h after the cell sheet is transfected.

[0148] (3) After 12 hing of the cell sheet, the corresponding plasmid / LiPO2000 is prepared.

[0149] (4) The plasmid (Overgraduated 1 ug, interference and interference control using 3 ug) was mixed with 250 ul of Opti-MEM for 5 min.

[0150] (5) At the same time as 4, 10 ul of LiPO2000 and 250 ul of OPTI-MEM were also mixed for 5 min.

[0151] (6) After five minutes, two mixed solutions were mixed into mixed 15 min after mixing together.

[0152] (7) At the same time, the original medium in the panel of yesterday, the original medium was absorbed, and 1 ml of Opti-MEM was added.

[0153] (8) After the incubation is completed, the 6 solution is added to the well plate and gently shake.

[0154] (9) Place the orifice plate in a 37 degree incubator culture.

[0155] (10) After the cultur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
refractive indexaaaaaaaaaa
Login to View More

Abstract

The invention discloses an adeno-associated virus for silencing the expression of RASGRP1 in the intestinal tract of mice, a preparation method and application thereof. The present invention designed three pairs of siRNA sequences for the RASGRP1 gene, and constructed the RasGRP1 shRNA interference vector. The qPCR target screening results showed that PAAVE2113, PAAVE2114 and PAAVE2115 all had silencing effects, among which PAAVE2115 had the best silencing effect, and the silencing efficiency was about 74%. Consistent with WB results. Co-transfect engineered cells with the interference vector and helper plasmid to obtain an adeno-associated virus that silences the expression of RASGRP1 in the intestinal tract of mice. Animal experiments have confirmed that using the adeno-associated virus to interfere with C57 mice can make RasGRP1 in the small intestine tissue of mice The protein expression decreased, and the way of intraperitoneal injection had the best interference effect.

Description

Technical field [0001] The present invention relates to the field of biotechnology, and in particular, it is a silent mouse intestinal RASGRP1 expression of glandular correlation virus and its preparation method thereof. Background technique [0002] RNA interference refers to highly conserved, homologous mRNA-induced homologous mRNA high-efficiency degradation in the evolutionary process, is a protective type of organism to resist external viruses and maintain genomic stability during evolution. mechanism. When the viral gene, artificial transfer gene, exogenous gene such as transformer is randomly integrated into the host cell genome, and some DSRNA is often produced when transcription using host cells. The host cell has a reaction to these DSRNAs, and the DICER of the RNASEII ribozyme family in the cytoplasm is cut into a plurality of small fragment RNA (i.e., siRNA) having specific lengths and structures. SiRNA declines into justice and antisense chains under the action of in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/85C12N15/864A01K67/027
CPCA01K67/0275C12N15/113C12N15/85C12N15/86C12N2310/141C12N2750/14143A01K2227/105A01K2217/058
Inventor 李俊燕陆灏陶枫陈清光徐隽斐侯瑞芳韩煦顾逸梦杨雪蓉金昕章丽琼陶乐维
Owner SHUGUANG HOSPITAL AFFILIATED WITH SHANGHAI UNIV OF T C M
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com