An adeno-associated virus that silences the expression of rasgrp1 in mouse intestinal tract and its preparation method and application
An intestinal and mouse technology, which is applied in the field of adeno-associated virus that silences the expression of RASGRP1 in the intestinal tract of mice and its preparation, and achieves a good effect of interference
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1 RASGRP1 overexpression plasmid construction
[0048] Experimental process
[0049] PCR amplification target gene. The gelatin recovery carrier fragment was carried out after expression of the carrier enzyme. The purpose gene was transferred to E.COLI sensitic cells after homologous recombination of the carrier fragment. Transformants were identified by colors PCR, positive cloning sequencing. Sequencing erroneous clones perform plasmid extraction. Experimental process figure 1 Indicated.
[0050] 2. Experimental materials
[0051] Reagent name Source of reagents Cat.no. Tool carrier Freight Biological Engineering (Shanghai) Co., Ltd. / Primestar Takara DR010A TAQ enzyme and DNTP Takara DR001B Seamless cloned kit Freight Biological Engineering (Shanghai) Co., Ltd. / NHEI-HF NEB R3131L Hindiii-HF NEB R3104L DH5A sensitive state cells Takara D9057 Small tetraerator Promega A1460 Agarose gel DNA recovery k...
Embodiment 2
[0097] Example 2RASGRP1SHRNA interference vector construction (3 targets)
[0098] Experimental process
[0099] PCR amplification target gene. The gelatin recovery carrier fragment was carried out after expression of the carrier enzyme. The purpose gene was transferred to E.COLI sensitic cells after homologous recombination of the carrier fragment. Transformants were identified by colors PCR, positive cloning sequencing. Sequencing erroneous clones perform plasmid extraction.
[0100] 2. Experimental materials
[0101]
[0102]
[0103] 3. Carrier map
[0104] Carrier map such as Figure 8 Indicated.
[0105] 4. Carrier
[0106] The tool carrier is used to extract the tool carrier with BSPEI and NHEI-HF, and the 5719 bp carrier fragment is recovered. Figure 9 Indicated.
[0107] 5. SiRNA design
[0108] Viral vector construction framework:
[0109] NO. 5’ STEMP Loop STEMP 3’ PaAVE2113-1 CCGG TCGACCGACCCAAATTAATT CTCGAG Aattaattggggtcgtgtcga TTTTTTTTTTT ...
Embodiment 3
[0145] Example 3 Overgraded and interfering plants total transfection 293T cells
[0146] (1) One day before transfection, the cells paveled.
[0147] (2) 12h after the cell sheet is transfected.
[0148] (3) After 12 hing of the cell sheet, the corresponding plasmid / LiPO2000 is prepared.
[0149] (4) The plasmid (Overgraduated 1 ug, interference and interference control using 3 ug) was mixed with 250 ul of Opti-MEM for 5 min.
[0150] (5) At the same time as 4, 10 ul of LiPO2000 and 250 ul of OPTI-MEM were also mixed for 5 min.
[0151] (6) After five minutes, two mixed solutions were mixed into mixed 15 min after mixing together.
[0152] (7) At the same time, the original medium in the panel of yesterday, the original medium was absorbed, and 1 ml of Opti-MEM was added.
[0153] (8) After the incubation is completed, the 6 solution is added to the well plate and gently shake.
[0154] (9) Place the orifice plate in a 37 degree incubator culture.
[0155] (10) After the cultur...
PUM
Property | Measurement | Unit |
---|---|---|
refractive index | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap