Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lactococcus lactis accumulating L-5-methyltetrahydrofolate and construction method thereof

A technology of methyltetrahydrofolate and methylenetetrahydrofolate, applied in the field of genetic engineering, can solve problems such as long metabolic pathways and complex biosynthesis processes, and achieve the effects of simple construction methods, easy use, and good application prospects

Inactive Publication Date: 2019-03-29
JIANGNAN UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the synthesis and accumulation level of folic acid substances in lactic acid bacteria is still high, the biosynthesis process is complex, and the metabolic pathway is long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Expression plasmid construction

[0031] Design primers according to the sequence information of plasmid pMG36e

[0032] pMG36e-F: 5'-TGACCGGTAAAATTTAATATTTTGAACCTTGCTT-3', pMG36e-R: 5'-TTCAAAATTCCTCCGAATATTTTTTTACCTACCTAGT-3', use the above primers to perform circular amplification on the plasmid pMG36e as a template; according to the Lactococcus lactis (Lactococcus lactis subsp.cremoris NZ9000, GenBank: CP002094.1) 5,10-methylenetetrahydrofolate reductase gene (metF, shown in SEQ ID NO.1), serine hydroxymethyltransferase gene (glyA, SEQ ID NO .2) design primers respectively:

[0033] metF-F: 5'-TATTCGGAGGAATTTTGAAATGACAAGTGATTCTAAAATTCTATCTTTTGAAGTTTTTTCC-3', metF-R: 5'-TATTAAATTTTACCGGTCATTATGTATTTTATTTTAAATAAAGATGAGATTGAAGAATGAATGGAACGTG-3':

[0034] glyA-F:5'-ATATTCGGAGGAATTTTGAAATGATTTTTGATAAAGAAGATTTTGAAAGCTTTGACC-3'

[0035] glyA-R:5'-TATTAAATTTTACCGGTCATTTATAATGGAAATTGATGTGTTAACTCTAAGGCAGAT-3';

[0036]Use the above primers to amplify the metF and...

Embodiment 2

[0037] The construction of embodiment 2 co-expression plasmids

[0038] Design primers according to the sequence information of plasmid pMG36e-glyA (constructed earlier in this experiment)

[0039] pMG36e-F2: 5'-TGACCGGTAAAATTTAATATTTTGAACCTTGCTT 3', pMG36e-R2: 5'-ATCAGCTCTGGAAGATCCTTATAATGGAAATTGATGTGTTAACTCTAAGGCAGAT-3', use the above primers to perform circular amplification of the plasmid pMG36e-glyA as a template; according to the Lactococcus lactis ( Lactococcuslactis sub sp.cremoris NZ9000) 5,10-methylenetetrahydrofolate reductase gene (metF), designed primers: metF-F2: 5'-ATATTCGGAGGAATTTTGAAATGACAAGTGATTCTAAAATTCTATCTTTTGAAGTTTTTC-3', metF-R2: 5'-TATTAAATTTTACCGGTCATTATGTATTGTATTTTAAATGAAAGAATGAATGAGA The above two amplified gene fragments were constructed with the Gibson Assembly Clonging Kit (New England Biolabs), and the recombinant plasmid was verified by double enzyme digestion and sequenced to confirm that the co-expression of the recombinant plasmid pMG36e-glyA...

Embodiment 3

[0040] Example 3 Construction of single gene overexpression Lactococcus lactis

[0041] The constructed expression plasmids pMG36e-metF and pMG36e-glyA were respectively transformed into Lactococcus lactis sub sp. cremoris NZ9000, and the transformed strains were named Lactococcus lactis NZ9000-M and NZ9000-G. Use metF-F and metF, glyA-F and glyA-R primers to select the corresponding transformants for colony PCR. After gel electrophoresis verification, 858bp bands and 1248bp bands appeared, respectively, to verify Lactococcus lactis NZ9000-M, NZ9000 -G build succeeds.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses lactococcus lactis accumulating L-5-methyltetrahydrofolate and a construction method thereof, and belongs to the field of genetic engineering. The recombinant lactococcus lactis provided by the invention can realize the intracellular accumulation of L-5-methyltetrahydrofolate, and the concentration of the L-5-methyltetrahydrofolate in microbial cells can reach 65 [mu]g / g DCW after 10 hours of fermentation so as to lay the foundation for further metabolic engineering of lactococcus lactis to produce L-5-methyltetrahydrofolate. The method for constructing the recombinantlactococcus lactis provided by the invention is simple, convenient to use, and has a good application prospect.

Description

technical field [0001] The invention relates to a Lactococcus lactis accumulating L-5-methyltetrahydrofolate and a construction method thereof, belonging to the field of genetic engineering. Background technique [0002] L-5-methyltetrahydrofolate is also known as (6S)-5-methyltetrahydrofolate, and its chemical name is (6S)-N-[4-[[(2-amino-1,4,5,6, 7,8-Hexahydro-4-oxo-5-methyl-6-pteridinyl)methyl]amino]benzoyl]-L-glutamic acid. L-5-Methyltetrahydrofolate is a derivative of folic acid, which can be directly absorbed by the human body and has good biological activity and function. Ordinary folic acid can only participate in the methylation process and DNA synthesis by converting it into L-5-methyltetrahydrofolate, which plays an indispensable role in life activities. [0003] L-5-Methyltetrahydrofolate can reduce cell spontaneous DNA damage and accelerate DNA repair. It is also a cofactor for methionine synthase, which catalyzes the conversion of homocysteine ​​to methionin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/53C12N15/54C12N15/74C12P17/18C12R1/01
CPCC12N9/0028C12N9/1014C12N15/74C12P17/182C12Y105/0102C12Y201/02001
Inventor 刘延峰堵国成卢川川李江华刘龙陈坚
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com