Lactococcus lactis accumulating L-5-methyltetrahydrofolate and construction method thereof
A technology of methyltetrahydrofolate and methylenetetrahydrofolate, applied in the field of genetic engineering, can solve problems such as long metabolic pathways and complex biosynthesis processes, and achieve the effects of simple construction methods, easy use, and good application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0030] Example 1 Expression plasmid construction
[0031] Design primers according to the sequence information of plasmid pMG36e
[0032] pMG36e-F: 5'-TGACCGGTAAAATTTAATATTTTGAACCTTGCTT-3', pMG36e-R: 5'-TTCAAAATTCCTCCGAATATTTTTTTACCTACCTAGT-3', use the above primers to perform circular amplification on the plasmid pMG36e as a template; according to the Lactococcus lactis (Lactococcus lactis subsp.cremoris NZ9000, GenBank: CP002094.1) 5,10-methylenetetrahydrofolate reductase gene (metF, shown in SEQ ID NO.1), serine hydroxymethyltransferase gene (glyA, SEQ ID NO .2) design primers respectively:
[0033] metF-F: 5'-TATTCGGAGGAATTTTGAAATGACAAGTGATTCTAAAATTCTATCTTTTGAAGTTTTTTCC-3', metF-R: 5'-TATTAAATTTTACCGGTCATTATGTATTTTATTTTAAATAAAGATGAGATTGAAGAATGAATGGAACGTG-3':
[0034] glyA-F:5'-ATATTCGGAGGAATTTTGAAATGATTTTTGATAAAGAAGATTTTGAAAGCTTTGACC-3'
[0035] glyA-R:5'-TATTAAATTTTACCGGTCATTTATAATGGAAATTGATGTGTTAACTCTAAGGCAGAT-3';
[0036]Use the above primers to amplify the metF and...
Embodiment 2
[0037] The construction of embodiment 2 co-expression plasmids
[0038] Design primers according to the sequence information of plasmid pMG36e-glyA (constructed earlier in this experiment)
[0039] pMG36e-F2: 5'-TGACCGGTAAAATTTAATATTTTGAACCTTGCTT 3', pMG36e-R2: 5'-ATCAGCTCTGGAAGATCCTTATAATGGAAATTGATGTGTTAACTCTAAGGCAGAT-3', use the above primers to perform circular amplification of the plasmid pMG36e-glyA as a template; according to the Lactococcus lactis ( Lactococcuslactis sub sp.cremoris NZ9000) 5,10-methylenetetrahydrofolate reductase gene (metF), designed primers: metF-F2: 5'-ATATTCGGAGGAATTTTGAAATGACAAGTGATTCTAAAATTCTATCTTTTGAAGTTTTTC-3', metF-R2: 5'-TATTAAATTTTACCGGTCATTATGTATTGTATTTTAAATGAAAGAATGAATGAGA The above two amplified gene fragments were constructed with the Gibson Assembly Clonging Kit (New England Biolabs), and the recombinant plasmid was verified by double enzyme digestion and sequenced to confirm that the co-expression of the recombinant plasmid pMG36e-glyA...
Embodiment 3
[0040] Example 3 Construction of single gene overexpression Lactococcus lactis
[0041] The constructed expression plasmids pMG36e-metF and pMG36e-glyA were respectively transformed into Lactococcus lactis sub sp. cremoris NZ9000, and the transformed strains were named Lactococcus lactis NZ9000-M and NZ9000-G. Use metF-F and metF, glyA-F and glyA-R primers to select the corresponding transformants for colony PCR. After gel electrophoresis verification, 858bp bands and 1248bp bands appeared, respectively, to verify Lactococcus lactis NZ9000-M, NZ9000 -G build succeeds.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com