Application of PA4608 protein as target in preparing antibacterial drugs

A technology of antibacterial drugs and targets, applied in the field of application in the preparation of antibacterial drugs

Inactive Publication Date: 2019-04-02
SOUTH CHINA AGRI UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, it has not been reported that the eight c-di-GMP receptors containing the PilZ domain are involved in the pathogenic infection process of bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of PA4608 protein as target in preparing antibacterial drugs
  • Application of PA4608 protein as target in preparing antibacterial drugs
  • Application of PA4608 protein as target in preparing antibacterial drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Construction of mapZ_R13A mutant strain

[0036] In this example, the mapZ_R13A mutant strain was constructed by homologous exchange recombination technology.

[0037] 1. A point mutation is carried out at the 13th arginine (R13) of the c-di-GMP binding site of the protein encoded by the gene PA4608, and the MapZ protein (its amino acid sequence is shown in SEQ ID NO.1, and its nucleotide sequence is shown in SEQ ID NO.2) and MapZ R13A The amino acid sequence of the protein is compared as figure 1 As shown, the gene synthesis method was used to synthesize mapZ containing upper and lower homology arms R13A A gene fragment, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0038] 2. Design primer F (CGCGGATCCTGGCGAAGATCGAGCGGCCG, SEQ ID NO.6) and primer R (CCCAAGCTTTGCCGAGCGGCCAGGAGCGC, SEQ ID NO.7), and use the DNA obtained in step 1 as a template for PCR amplification. The reaction system is shown in Table 1:

[0039] Table 1 PCR reaction system

...

Embodiment 2

[0045] Example 2 Construction of ΔmapZ mutant strain

[0046] In this example, the ΔmapZ mutant strain was constructed by homologous exchange recombination technology.

[0047] 1. To knock out the mapZ gene, design primers P1 (CGCGGATCCAAGTGCGCCCGGTCCTTGGCTT, SEQ ID NO.8) and P2 (CCCTCTTCGAGTGACCCGCCTCTCATGTCGCGATCCCTTGGTGC, SEQ ID NO.9), and use PAO1 genomic DNA as a template to amplify the homology arm on the mapZ gene. The reaction system is as follows Shown in Table 2; Design primers P3 (GCACCAAGGGATCGCGACATGAGAGGCGGGTCACTCGAAGAGGG, SEQ ID NO.10) and P4 (CCCAAGCTTCCGTACTGTATTTCGAGGGCGA, SEQ ID NO.11), using PAO1 genomic DNA as a template to amplify the lower homology arm of the mapZ gene, the reaction system is shown in Table 3 Show.

[0048] Table 2 PCR reaction system

[0049]

[0050] Table 3 PCR reaction system

[0051]

[0052] The PCR amplification conditions were: pre-denaturation at 98°C for 30s, denaturation at 98°C for 10s, annealing at 65°C for 30s, ext...

Embodiment 3

[0059] Example 3 Construction of ΔhapZ mutant strain

[0060] In this example, the ΔhapZ mutant strain was constructed by homologous exchange recombination technology.

[0061] 1. Knockout the hapZ gene (ie PA2799), design primers P5 (CGCGGATCCAAAGTACGATGATCGGCGTTTC, SEQ ID NO.13) and P6 (CGCCTTTCGTCGTTTCAGTGGAGCTCGATGGGCTGCATGGGCTG, SEQ ID NO.14), and use PAO1 genomic DNA as a template to amplify the homology of the hapZ gene Arm, the reaction system is the same as in Table 2; primers P7 (CAGCCCATGCAGCCCATCGAGTCCCACTGAAACGACGAAAGGCG, SEQ ID NO.15) and P8 (CCCAAGCTTTTGCAGGCCAAGTTCCCAATG, SEQ ID NO.16) were designed to amplify the lower homology arm of the hapZ gene with PAO1 genomic DNA as a template, and the reaction system is the same as in the table 3.

[0062] The PCR amplification conditions were: pre-denaturation at 98°C for 30s, denaturation at 98°C for 10s, annealing at 65°C for 30s, extension at 72°C for 30s, a total of 30 cycles, extension at 72°C for 5min, and stor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of PA4608 protein as a target in preparing antibacterial drugs. By constructing a PA4608 (mapZ) site mutant strain mapz_R13A and a mapZ whole gene knockout mutant and by utilizing a nematode-quick killing infection model, a scratch cell model and a mouse abdominal infection model for study, the invention first puts forwards that the c-di-GMP binding site of PA4608 protein plays an important regulatory role in pseudomonas aeruginosa infection process, puts forwards that the site is a key site for the pathogenicity of the pseudomonas aeruginosa, and furtherputs forwards a new target, namely a c-di-GMP receptor PA4608 used for preventing and / or treating the pseudomonas aeruginosa. The invention provides an important theoretical basis for the developmentof new antibacterial drugs, especially for the design of new antibacterial drugs based on c-di-GMP receptor induction mechanism, provides an important theoretical reference for the prevention and clinical treatment of pseudomonas aeruginosa infection, and has important practical significance.

Description

technical field [0001] The invention belongs to the field of microbial biotechnology, and particularly relates to the application of PA4608 protein as a target in the preparation of antibacterial drugs. Background technique [0002] Pseudomonas aeruginosa (PA), also known as Pseudomonas aeruginosa, is a Gram-negative bacterium that widely exists in nature and is distributed in various ecological environments such as soil, ocean, animals and plants. At the same time, it is also one of the most common human conditional pathogens, which can cause acute infections such as pneumonia, urinary tract infection, and sepsis, especially for patients with low immunity, including patients with metabolic diseases, AIDS patients, organ transplants, and extensive burns Therefore, it is one of the main pathogenic bacteria of hospital-acquired infection in the world. 10% to 20% of nosocomial infections worldwide are caused by Pseudomonas aeruginosa. In recent years, the detection rate and i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/90C12R1/385
CPCC07K14/21C12N15/902
Inventor徐领会盛硕辛凌翼刘琼黎钊廷王俊霞周佳暖梁照珣
OwnerSOUTH CHINA AGRI UNIV