Method for detecting bacteria by amplifying conserved region sequence of 16S rDNA

A technology for sequence detection and conserved regions, applied in the field of bioengineering, can solve the problems of heavy workload, long time, and prone to false negatives, and achieve the effects of convenient operation, high sensitivity, and significant technological progress.

Inactive Publication Date: 2019-04-02
TONGJI UNIV +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the above technical problems in the prior art, the present invention provides a method for detecting bacteria by amplifying the 16S rDNA conserved region sequence, and the method for detecting bacteria by amplifying the 16S rDNA conserved region sequence will solve the existing The method of detecting bacteria in the technology has cumbersome steps, heavy workload, long time-consuming, and prone to false negative technical problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting bacteria by amplifying conserved region sequence of 16S rDNA
  • Method for detecting bacteria by amplifying conserved region sequence of 16S rDNA
  • Method for detecting bacteria by amplifying conserved region sequence of 16S rDNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] 1. Preparation of primers and standards

[0021] 1. The forward primer of the present invention: 5'-cagcagccgcggtaatac-3' (shown in SEQ ID NO.1); or

[0022] 5'-cagcagccgcggtaattc-3' (shown in SEQ ID NO.2); or

[0023] 5'-cagccgccgcggtaatac-3' (shown in SEQ ID NO.3); or

[0024] 5'-cagccgccgcggtaattc-3' (shown in SEQ ID NO.4); or

[0025] 2. Reverse primer: 5'-ggactaccagggtatctaat-3'. Synthesized by Sunny Corporation. Primers were dissolved in water to a concentration of 10 μM.

[0026] 3. The standard product of the present invention is the pUC57 plasmid containing the partially conserved region sequence of 16S rDNA, synthesized by Sunny Company. The base number of pUC57 is 2710bp. 16S rDNA部分保守区序列为ccgtgc cagcagccgc ggtaatacggagggtgcaag cgttaatcgg aattactggg cgtaaagcgc acgcaggcgg tttgttaagt cagatgtgaaatccccgggc tcaacctggg aactgcatct gatactggca agcttgagtc tcgtagaggg gggtagaattccaggtgtag cggtgaaatg cgtagagatc tggaggaata ccggtggcga aggcggcccc ctggacgaagactgacgctc agg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided is a method for detecting bacteria by amplifying a conserved region sequence of 16S rDNA. The conserved region sequence of bacteria 16S rDNA is amplified by an RT-PCR method. A standard product is a pUC57 plasmid containing a part of conserved region sequence of 16S rDNA. A PCR reaction system contains 200 nM forward primer and 200 nM reverse primer, a proper amount of a template is added, a standard curve is established by the pUC57 plasmid containing a part of conservative region sequence of 16S rDNA, and then the concentration of bacteria is calculated according to the CT value ofa sample to be tested. According to the method, when the threshold value is set at 10000, the CT value of the sample to be tested is less than 35 and the Tm is between 83.6 DEG C-85 DEG C, bacterial contamination exists, the escherichia coli concentration limit which can be detected is 3-33 cfu / [mu]l, the DNA copying number limit which can be detected is about 1.6*10<2> copies, and the result canbe obtained in 2 h.

Description

technical field [0001] The invention belongs to the field of bioengineering and relates to a detection method, in particular to a method for detecting bacteria by amplifying the 16S rDNA conserved region sequence. Background technique [0002] Bacteria are small in size, diverse in shape, diverse in variety, fast in reproduction, and tenacious in their vitality. They are extremely harmful in basic research and clinical trials. Bacterial contamination is a common contamination problem in cell culture. Bacterial proliferation will consume nutrient solution, and the toxins produced at the same time will make the cell surface rough, inhibit cell growth, and in severe cases, stop cell growth, and eventually cause cell rupture and death. In addition, once pathogenic bacteria enter the human body, they can cause a variety of infections and infectious diseases, such as tetanus, typhoid, and tuberculosis. Antibiotics can prevent bacterial contamination and infection, but cannot com...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6851C12Q1/689C12Q1/14C12Q1/10C12Q1/04
CPCC12Q1/6851C12Q1/689C12Q2521/107C12Q2563/107
Inventor赵简雷颖白志慧张守梅
OwnerTONGJI UNIV