Preparation method, purification method and applications of PEG-modified recombinant humanized urate oxidase

A technology of urate oxidase and urate oxidase protein, which is applied in the field of protein engineering and can solve problems such as sensitivity, loss of enzyme activity, and intolerance

Active Publication Date: 2019-06-07
张文宇
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] As an acid-lowering drug for gout treatment, urate oxidase mainly has the following four problems in the process of industrialization and clinical application: 1. How to reduce immunogenicity to meet the requirements of repeated administration; 2. How to Maximize the retention of enzyme activity; 3. How to make urate oxidase better in solubility and maintain biological function under physiological pH conditions; 4. How to prolong the half-life of uricase in vivo and reduce the frequency of administration
However, there are still some problems in the industrialization process of uricase derived from mammals. In the purification process, uricase derived from mammals is insoluble under physiological pH conditions, so traditional purification methods can only be used at higher After dissolving it under the condition of pH (8.5-9.2), it is purified by xanthine affinity chromatography. In this process, uricase will be exposed to high pH conditions for a long time, and part of its enzyme activity will be lost.
[0006] Early about urate oxidase mainly focused on non-human urate oxidase, such as the microbial source urate oxidase disclosed in CN101402688A (such as Aspergillus flavus, Candida, plants, etc.), but the existence of microbial urate oxidase and human uric acid oxidation The problem of poor sequence homology of enzyme genes
Later, there were patent reports on mammalian urate oxidase, such as the pegylated canine urate oxidase disclosed in CN102634492A, but its ability to reduce uric acid in animal experiments was not ideal. Although CN103834623A disclosed a low immunogen Uric acid-lowering human urate oxidase, but it has not been modified with PEG, which makes the urate oxidase more sensitive to pH and cannot tolerate higher pH, and there will be a problem of reduced enzyme activity during production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method, purification method and applications of PEG-modified recombinant humanized urate oxidase
  • Preparation method, purification method and applications of PEG-modified recombinant humanized urate oxidase
  • Preparation method, purification method and applications of PEG-modified recombinant humanized urate oxidase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Construction of humanized urate oxidase high-expression strain

[0077] The sequence (SEQ ID NO :3), after adding NcoI (CCATGG) and XhoI (CTCGAG) double restriction sites at the front and rear ends of SEQ ID NO: 3, artificially synthesized SEQ ID NO: 4 (for Suzhou Jinweizhi Biotechnology Co., Ltd.), after synthesis The sequence of SEQ ID NO: 4 was double digested (NcoI and XhoI) and connected to the same double digested pET-28a vector, and then transformed into DH5α cells to amplify and extract the plasmid to obtain an expression vector.

[0078] SEQ ID NO:4

[0079]CCATGGATTATAAGAAAAATGATGAAGTGGAGTTTGTGCGCACCGGCTATGGCAAGGAAATGGTGAAGGTGCTGCACATCCAGCGTGATGGCAAATATCATAGCATTAAAGAAGTGGCCACCAGCGTGCAGCTGACCCTGAGCAGCAAAAAGGATTACCTGCACGGCGACAACAGCGATATCATTCCGACCGACACCATCAAGAATACCGTGCATGTGCTGGCCAAATTCAAGGGCATCAAGAGCATCGAGGCCTTCGCCATGAATATCTGCGAGCATTTTCTGAGCAGCTTCAACCACGTGATTCGTGCCCAGGTGTATGTGGAAGAAGTGCCGTGGAAGCGCTTCGAGAAAAATGGCGTGAAGCACGTGCATGCCTTTATCCATACCCCGACCGGCACCCACTTTTGC...

Embodiment 2

[0082] Expression and purification of humanized urate oxidase

[0083] Step (1). Protein expression:

[0084] a) Recovery of the target strain: take out the target bacteria frozen in glycerol from -80°C, dilute 100,000-fold with LB in a clean bench, spread it on an LB plate with 50 μg of Kanamycin, place it upside down in a 37°C incubator, and cultivate overnight Store in a refrigerator at 4°C and recover after 2 months.

[0085] b) Seed culture: Prepare 70ml of 50μg Kanamycin LB sterile medium in a 200ml triangular medicine bottle, pick a single colony on the plate and place it in the medium, and culture it overnight in a shaker at 37°C and 180rpm.

[0086] c) Batch culture and induced expression: Prepare 400ml of 50μg Kanamycin LB sterile medium in a 1L Erlenmeyer shaker flask, add 4ml of seed solution to the 400ml medium in an ultra-clean workbench (shake well before absorbing), seal and place in Cultivate in a shaker at 37°C and 250 rpm. Waiting for OD 600 At 0.6-0.8 (...

Embodiment 3

[0106] Step (4) Add 10% sucrose to the buffer solution, then add CH 3 COOH reduces the pH of the buffer to 8.5, and the rest of the steps are exactly the same as in Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method and purification method of recombinant humanized urate oxidase, a nucleic acid sequence encoding recombinant humanized urate oxidase protein, a plasmid vector expressing the recombinant urate oxidase protein and engineering bacteria. According to the invention, a human uricase pseudogene sequence is used as a template to carry out mutation on the sitethereof, so that the recombinant humanized urate oxidase with activity and higher homology (92.6%) than the human pseudogene sequence is obtained. Meanwhile, a purification process is improved, and the activity loss of uricase in the purification process is reduced to the maximum extent. The high-dose humanized urate oxidase prepared by the method shows obvious effect of relieving pain caused by sodium urinate crystallization after two days of dosing, and has the same symptom relief degree as a sham operation group after 4 days of dosing, which indicates that the symptom is completely relievedand obvious progress is realized.

Description

technical field [0001] The invention belongs to the field of protein engineering, and specifically relates to a preparation method and a purification method of PEG-modified recombinant humanized urate oxidase, a nucleic acid sequence encoding recombinant humanized urate oxidase protein, a plasmid vector expressing recombinant urate oxidase protein, and an engineering bacterium . Background technique [0002] Gout is a crystal-associated arthropathy caused by deposition of monosodium urate (MSU), which is directly related to hyperuricemia caused by purine metabolic disorders and / or decreased uric acid excretion, and belongs to metabolic rheumatism. According to incomplete statistics from the Rheumatology Branch of the Chinese Medical Association in 2016, the prevalence of gout in my country is 1% to 3%, and it is increasing year by year. [0003] Urate oxidase (uricase, E.C.1.7.3.3) is a key enzyme in purine metabolism in organisms, which can degrade insoluble uric acid into...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N15/70C12N1/21C12N9/06A61K47/60A61K38/44A61P9/10
Inventor张文宇
Owner张文宇