Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Flaggelin-fiber2 fusion protein, and preparation method and application thereof

A fusion protein and protein technology, applied in the biological field, can solve the problems of imperfect effect and poor control of poultry type 4 adenovirus disease, and achieve good immune protection, good immunogenicity and reactivity, and good immunity The effect of protection

Active Publication Date: 2019-06-11
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Vaccines have a certain effect on the prevention and control of poultry adenovirus type 4 disease, but the disease still occurs and spreads, indicating that inactivated vaccines that can only produce humoral immune responses cannot control poultry type 4 adenovirus disease well
Humoral immunity and cellular immunity play an important role in the body's immune system, and the currently used inactivated vaccines cannot stimulate the body to produce a cellular immune response, resulting in imperfect effects on the prevention and control of FAdV-4 infection. Therefore, how to develop a vaccine that can Simultaneous activation of humoral and cellular immune responses is the direction of FAdV-4 vaccine research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Flaggelin-fiber2 fusion protein, and preparation method and application thereof
  • Flaggelin-fiber2 fusion protein, and preparation method and application thereof
  • Flaggelin-fiber2 fusion protein, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Fusion expression of avian type 4 adenovirus fiber2 protein and Salmonella typhimurium flagellin flagellin in Sf9 insect cells

[0040] 1.1. Construction of recombinant vector

[0041] (1) PCR amplification of the flagellin-fiber2 gene: the nucleic acid sequence of the artificially synthesized flagellin-fiber2 gene is shown in SEQ ID NO.2.

[0042] The upstream and downstream primers of flagellin-fiber2 are:

[0043] Upstream primer (P1, SEQ ID NO.3): CC GCGGCCGC TTATGGCACAAGTAATCAACA;

[0044] Downstream primer (P2, SEQ ID NO.4): CG AAGCTT AATTACGGGAGGGAGGCCGCTGGA;

[0045] Among them, P1 contains the NotI restriction site, see the underline, and P2 contains the HindIII restriction site, see the underline. After optimizing the PCR reaction conditions and reagents, a 20 μl reaction system was established, as shown in Table 1:

[0046] Table 1: Quantities of Specific Substances Used in PCR Reaction

[0047] template

2μl

Taq polymeras...

Embodiment 2

[0072] Example 2 Study on the immune protection of the fusion expression product of avian type 4 adenovirus fiber2 protein and Salmonella typhimurium flagellin protein

[0073] (1) Immunoprotective effect of attacking SPF chickens after immunization

[0074] 80 SPF chickens (provided by Beijing Meria Weitong Experimental Animal Technology Co., Ltd.) were randomly divided into 4 groups, respectively positive challenge group (inoculated with FAdV-4 group), non-challenged group (unvaccinated with FAdV-4 group) ), 20 μg flagellin-fiber2 recombinant protein immunization group, PBS inoculation group. FAdV-4 was provided by the research group of Liu Jue, Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agriculture and Forestry Sciences. 21 days after the immunization of the SPF chickens, the SPF chickens of the 4 groups were inoculated intramuscularly with the FAdV-4 liver tissue grinding virus solution (provided by the laboratory of the Animal Science and T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a flaggelline-fiber2 fusion protein as well as a preparation method and application thereof. The fusion protein is a fusion protein of a fowl adenovirus type 4 fiber2 protein with relatively high immunoprotection and a salmonella typhimurium flagellin. The preparation method comprises the following steps: cloning an artificially coded flaggin-fiber2 gene into a pFastBac-HA expression vector through fusion; carrying out gene transposition to form recombinant Bacmid, transfecting the recombinant Bacmid into Sf9 insect cells, expressing the fusion protein by utilizing a baculovirus system, and conducting identifying by virtue of indirect immunofluorescence IFA and Western blot. The period of obtaining the recombinant baculovirus through the system is short, and when SPFchicken are immunized by the flaggin-fibe2 fusion protein, results show that the flaggin-fibe2 fusion protein expressed by the baculovirus system has high immunoprotection capability.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a fusion protein flagellin-fiber2 of avian type 4 adenovirus fiber2 protein and Salmonella typhimurium flagellin protein, its preparation method and application. Background technique [0002] Fowl adenovirus (Fowl Adenovirus, FAdV) is a member of the Adenoviridae adenovirus genus, is a DNA virus, and is one of the common infectious disease pathogens in poultry and wild birds. FAdV can be divided into three groups Ⅰ, Ⅱ and Ⅲ according to group-specific antigens. According to the results of the cross-neutralization test, group I avian adenovirus can be divided into 12 serotypes, and different serotypes have the same group antigen. In recent years, clinical cases of inclusion body hepatitis (Inclusion body hepatitis, IBH) and hydropericardium syndrome (HPS) in chickens caused by adenovirus infection of subgroup I have increased significantly, among which poultry 4 The numb...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/866C12N15/66A61K39/39A61K39/235A61P31/20
Inventor 侯磊刘爵韦莉王菁全荣朱珊珊
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com