Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus thuringiensis insecticidal gene cry79aa1, expressed protein and its application

A technology of insecticidal genes and insecticidal proteins, applied in application, insecticide, genetic engineering, etc., can solve problems such as singleness and increase in insect resistance, and achieve the effect of delaying drug resistance

Active Publication Date: 2021-08-31
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Since the current commercialized transgenic insect-resistant crops have relatively single types of insect-resistant genes, such large-scale promotion of planting has the risk of reducing pest refuges and increasing pest resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus thuringiensis insecticidal gene cry79aa1, expressed protein and its application
  • Bacillus thuringiensis insecticidal gene cry79aa1, expressed protein and its application
  • Bacillus thuringiensis insecticidal gene cry79aa1, expressed protein and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1. Obtaining new genes

[0025] Through whole-genome sequencing, it was found that the genome of the strain BtLTS290 contained a cry gene with a high similarity to cry19Bb, and full-length primers were designed

[0026] 5cry79Aa f TTATTTCGGATAGTTATTGTTATA

[0027] cry79Aa r TTGGATTCATATCCTAAAAAAGAATG,

[0028] Using pfuDNA polymerase, PCR amplification was performed with the following system.

[0029]

[0030] Make up to 50 μL with ultrapure water, mix well and centrifuge.

[0031] Amplification cycle: Denaturation at 94°C for 1 minute, annealing at 54°C for 1 minute, extension at 72°C for 1 minute, 25 cycles, and finally extension at 72°C for 10 minutes. Such as figure 1 shown.

[0032] 1.2 Connection scheme

[0033]

[0034] Make up the volume to 10 μL with ultrapure water, mix thoroughly, and connect at 16°C for 4 hours or overnight at 4°C.

[0035] Design full-length primers for the cry79Aa1 gene, amplify the full-length gene, connect it to the...

Embodiment 2

[0048] Embodiment 2, gene expression and activity assay

[0049] 2.1.1 Plasmid DNA was extracted from the above clone, and transformed into the recipient strain Rosetta (DE3) to obtain an expression strain.

[0050] After IPTG induced expression, SDS-PAGE protein electrophoresis was performed.

[0051] The process of inducing expression is as follows:

[0052] 1) Activated strains (37°C, 12hr);

[0053] 2) 10% inoculated in LB medium (37°C, 2hr);

[0054] 3) Add the inducer IPTG, 150rpm, and induce at 18-22°C for 4-20h at low temperature;

[0055] 4) The cells were collected by centrifugation, and 10 mM Tris Cl (pH 8.0) was added to suspend;

[0056] 5) Broken bacteria (ultrasonic crushing is complete);

[0057] Centrifuge at 12,000rpm for 10min at 4°C;

[0058] Collect 10-15 μL each of the supernatant and the precipitate, and detect them by electrophoresis.

[0059] The polyacrylamide gel configuration is as follows.

[0060]

[0061] Sample loading: 10-15μl sample...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a Bacillus thuringiensis insecticidal gene cry79Aa1, an expression protein and an application thereof, and belongs to the technical field of biological control. The insecticidal protein Cry79Aa isolated from Bacillus thuringiensis LTS290 (the deposit number: CGMCC No. 10232) has the amino acid sequence shown in SEQ ID NO. 2, and the gene encoding the insecticidal protein, preferably the gene The nucleotide sequence is shown in SEQ ID NO.1. The above-mentioned genes have certain virulence to lepidopteran pests, and can be applied to transform microorganisms and plants to show toxicity to related pests, and to overcome and delay the generation of drug resistance of pests to engineering bacteria and transgenic plants.

Description

technical field [0001] The invention relates to the technical field of biological control, in particular to a Bt insecticidal gene with high toxicity to lepidopteran agricultural pests and a protein encoded by the gene. Background technique [0002] Bacillus thuringiensis (Bt) is a widely distributed Gram-positive bacterium, an entomopathogenic microorganism with strong toxicity to pests and no toxicity to natural enemies, and no toxicity to higher animals and humans. It is currently the most in-depth study and the most widely used microbial insecticide, and it is active against more than 3000 kinds of pests in 16 orders. Bt can form insecticidal crystal proteins (Insecticidal Crystal Proteins, ICPs), also known as δ-endotoxin (delta-endotoxin) during the sporulation stage, its shape, structure and size are closely related to its virulence [Schnepf.E, Crickmore .N,Van Rie.J.,Lereclus.D,Baum.J,Feitelson.J,Zeigler.D.R.,Dean.D.H.Bacillus thuringiensis and its pesticidal crysta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/325C12N15/32C12N15/70C12N15/82C12N1/21A01H5/00A01H6/00A01N47/44A01P7/04
Inventor 李海涛刘荣梅高继国张杰
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com