Bacillus thuringiensis insecticidal gene cry79aa1, expressed protein and its application
A technology of insecticidal genes and insecticidal proteins, applied in application, insecticide, genetic engineering, etc., can solve problems such as singleness and increase in insect resistance, and achieve the effect of delaying drug resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1. Obtaining new genes
[0025] Through whole-genome sequencing, it was found that the genome of the strain BtLTS290 contained a cry gene with a high similarity to cry19Bb, and full-length primers were designed
[0026] 5cry79Aa f TTATTTCGGATAGTTATTGTTATA
[0027] cry79Aa r TTGGATTCATATCCTAAAAAAGAATG,
[0028] Using pfuDNA polymerase, PCR amplification was performed with the following system.
[0029]
[0030] Make up to 50 μL with ultrapure water, mix well and centrifuge.
[0031] Amplification cycle: Denaturation at 94°C for 1 minute, annealing at 54°C for 1 minute, extension at 72°C for 1 minute, 25 cycles, and finally extension at 72°C for 10 minutes. Such as figure 1 shown.
[0032] 1.2 Connection scheme
[0033]
[0034] Make up the volume to 10 μL with ultrapure water, mix thoroughly, and connect at 16°C for 4 hours or overnight at 4°C.
[0035] Design full-length primers for the cry79Aa1 gene, amplify the full-length gene, connect it to the...
Embodiment 2
[0048] Embodiment 2, gene expression and activity assay
[0049] 2.1.1 Plasmid DNA was extracted from the above clone, and transformed into the recipient strain Rosetta (DE3) to obtain an expression strain.
[0050] After IPTG induced expression, SDS-PAGE protein electrophoresis was performed.
[0051] The process of inducing expression is as follows:
[0052] 1) Activated strains (37°C, 12hr);
[0053] 2) 10% inoculated in LB medium (37°C, 2hr);
[0054] 3) Add the inducer IPTG, 150rpm, and induce at 18-22°C for 4-20h at low temperature;
[0055] 4) The cells were collected by centrifugation, and 10 mM Tris Cl (pH 8.0) was added to suspend;
[0056] 5) Broken bacteria (ultrasonic crushing is complete);
[0057] Centrifuge at 12,000rpm for 10min at 4°C;
[0058] Collect 10-15 μL each of the supernatant and the precipitate, and detect them by electrophoresis.
[0059] The polyacrylamide gel configuration is as follows.
[0060]
[0061] Sample loading: 10-15μl sample...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap