Bacillus megaterium P5-2 and separation method and application thereof

[0029] Example 1

[0030] Isolation of Bacillus megaterium P5-2

[0031] S1, sampling

[0032] In the Tilapia Factory Recirculating Aquaculture Workshop of Panyu Fine Breeding Farm in Guangzhou City, aquaculture water samples and biological fillers are taken and stored in a refrigerator at 4°C for enrichment and separation;

[0033] S2, preliminary screening

[0034] Add 120mL of No. 5 enrichment and separation medium in a 250ml Erlenmeyer flask, use a 100mL graduated cylinder to take 20mL water sample and add it to a 50mL centrifuge tube, shake for about 30s, and put it into No. 5 enrichment and separation solid medium (containing 15 biological Filler), placed in a shaker at 32°C and 180r/min for 5-7 days, repeat the above operation twice, take the third enriched culture solution and dilute it to 10 -3 , 10 -4 , 10 -5 , Take 150μL each of the dilutions, apply to No. 5 enriched and separate solid medium, make 2 dishes for each dilution concentration, and place them in a constant temperature incubator at 32°C for 1-3 days; use an inoculation loop to select single colonies and inoculate to No. 5 enrichment and separation solid medium plate was purified and cultured, and pure strains were obtained after multiple streaking purification cultures;

[0035] S3, re-screening

[0036] The above-obtained pure strains to be tested were respectively inoculated into heterotrophic nitrification medium and cultured in a constant temperature shaker at 32°C and 180r/min. After 24 hours, the NH in the culture solution was detected. 4 + -N, select NH 4 + -The strain with the lowest N content is Bacillus megaterium P5-2.

[0037] The above-mentioned No. 5 enrichment and separation solid medium includes the following components: 0.7g/L KNO 3 , 2.75g/L glucose, 1.24g/L KH 2 PO 4 ·2H 2 O, 3.046g/L of K 2 HPO 4 ·3H 2 O, 4g/L NaCl, 3mL trace element solution and 15g/L agar. The pH of the No. 5 enrichment and separation solid medium is 7.5; the trace element solution includes the following components: 3g/L MgSO 4 ·7H 2 O, 1.12g/L H 3 BO 3 , 3g/L MnSO 4 , 0.3g/L FeSO 4 ·7H 2 O, 3g/L Z nSO 4 ·7H 2 O, 0.6g/L CaCl 2.

[0038] The aforementioned heterotrophic nitrification medium includes the following components: 0.4g/L (NH 4 ) 2 SO 4 , 5g/L sodium citrate, 0.01g/L NaCl, 0.05g/L MgSO 4 ·7H 2 O, 0.2g/L K 2 HPO 4 , 0.01g/L FeSO 4 ·7H 2 O, 0.01g/L MnSO 4 The pH of the heterotrophic nitrification medium is 7.0.

[0039] 16S rRNA gene of strain P5-2

[0040] Use the bacterial DNA extraction kit to extract the bacterial genomic DNA of the strain to be tested. Refer to the instructions for the specific operation steps. Use the extracted bacterial genomic DNA as a template to amplify the bacteria and amplify the primers for 16S rRNA:

[0041] 27F: 5'–GTTTGATCCTGGCTCAG–3';

[0042] 1492R: 5'–TACGGCTACCTTGTTACGACTT–3'.

[0043] The reaction system (25μL) is: template DNA 1μL, forward and reverse primers 0.5μL each, Mix 12.5μL, sterile distilled water 10.5μL, PCR amplification reaction conditions: 94℃3min; 94℃30s, 56℃30s, 72℃ 90s, 30 cycles; 72°C for 10 minutes. The PCR product was sent to Guangzhou Aiki Biotechnology Co., Ltd. for sequencing, and the sequence measured is shown in SEQ ID NO.1.

[0044] The strain has been deposited in the Guangdong Province Microbial Culture Collection Center on January 7, 2019. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City. The strain name: Bacillus megaterium P5- 2. The deposit number is GDMCC NO.60536.

[0045] Example 2

[0046] The isolated and purified Bacillus megaterium (Bacillus megaterium) P5-2 with high efficient denitrification, the colony morphology on LB solid medium is like figure 1 As shown, the Gram stain is positive ( figure 2 ); Hydrolyzable starch ( Figure 3-1 ) And casein ( Figure 3-2 );

[0047] Example 3

[0048] The safety of strain P5-2 to tilapia was tested by intraperitoneal injection and soaking. The results of the injection experiment showed that the concentration of 100μL injection of tilapia with a body weight of (6.5±1.5)g was 1.5×10 7 CFU/ml, 1.5×10 8 CFU/ml and 1.5×10 9 Under the condition of CFU/mL bacterial liquid, there was no death or other abnormal conditions; the immersion experiment results showed that the concentration of P5-2 in the water body was 1.5×10 6 CFU/mL and 1.5×10 7 In the case of CFU/mL, tilapia weighing (1.0±0.5)g did not die first and other abnormal phenomena. The above results indicate that P5-2 is a strain with good safety performance.