Bacillus megaterium P5-2 and separation method and application thereof

A technique for the isolation of Bacillus megaterium, applied in the field of Bacillus megaterium P5-2 and its isolation, can solve the problems of weak environmental adaptability, slow growth of strains, and low denitrification efficiency, and achieve strong environmental adaptability and growth Fast speed and high nitrogen removal efficiency

Active Publication Date: 2019-06-28
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
4 Cites 6 Cited by

AI-Extracted Technical Summary

Problems solved by technology

[0003] However, in the practical application of microbial nitrogen removal method, because it is an oligotrophic condition, the gro...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Abstract

The invention belongs to the field of microorganism application, and specifically relates to a strain of bacillus megaterium P5-2 and a separation method and application thereof. The bacillus megaterium P5-2 is preserved in the Guangdong Microbial Culture Collection Center on January 7th, 2019, and the preservation number is GDMCC NO.60536. The bacillus megaterium is high in growth speed, denitrification efficiency and environmental adaptability and has no damage to aquatic products, the ammonia nitrogen removal rate under oligotrophic conditions is 60% or above, and ammonia nitrogen in waterand nitrite nitrogen can both be removed. When the bacillus megaterium is used as a nitrogen removal agent, since the bacillus megaterium has no damage to the aquatic products, the bacillus megateriumis particularly suitable for removing nitrogen from the aquaculture water.

Application Domain

Technology Topic

ChemistryNitrite nitrogen +9

Image

  • Bacillus megaterium P5-2 and separation method and application thereof
  • Bacillus megaterium P5-2 and separation method and application thereof
  • Bacillus megaterium P5-2 and separation method and application thereof

Examples

  • Experimental program(5)

Example Embodiment

[0029] Example 1
[0030] Isolation of Bacillus megaterium P5-2
[0031] S1, sampling
[0032] In the Tilapia Factory Recirculating Aquaculture Workshop of Panyu Fine Breeding Farm in Guangzhou City, aquaculture water samples and biological fillers are taken and stored in a refrigerator at 4°C for enrichment and separation;
[0033] S2, preliminary screening
[0034] Add 120mL of No. 5 enrichment and separation medium in a 250ml Erlenmeyer flask, use a 100mL graduated cylinder to take 20mL water sample and add it to a 50mL centrifuge tube, shake for about 30s, and put it into No. 5 enrichment and separation solid medium (containing 15 biological Filler), placed in a shaker at 32°C and 180r/min for 5-7 days, repeat the above operation twice, take the third enriched culture solution and dilute it to 10 -3 , 10 -4 , 10 -5 , Take 150μL each of the dilutions, apply to No. 5 enriched and separate solid medium, make 2 dishes for each dilution concentration, and place them in a constant temperature incubator at 32°C for 1-3 days; use an inoculation loop to select single colonies and inoculate to No. 5 enrichment and separation solid medium plate was purified and cultured, and pure strains were obtained after multiple streaking purification cultures;
[0035] S3, re-screening
[0036] The above-obtained pure strains to be tested were respectively inoculated into heterotrophic nitrification medium and cultured in a constant temperature shaker at 32°C and 180r/min. After 24 hours, the NH in the culture solution was detected. 4 + -N, select NH 4 + -The strain with the lowest N content is Bacillus megaterium P5-2.
[0037] The above-mentioned No. 5 enrichment and separation solid medium includes the following components: 0.7g/L KNO 3 , 2.75g/L glucose, 1.24g/L KH 2 PO 4 ·2H 2 O, 3.046g/L of K 2 HPO 4 ·3H 2 O, 4g/L NaCl, 3mL trace element solution and 15g/L agar. The pH of the No. 5 enrichment and separation solid medium is 7.5; the trace element solution includes the following components: 3g/L MgSO 4 ·7H 2 O, 1.12g/L H 3 BO 3 , 3g/L MnSO 4 , 0.3g/L FeSO 4 ·7H 2 O, 3g/L Z nSO 4 ·7H 2 O, 0.6g/L CaCl 2.
[0038] The aforementioned heterotrophic nitrification medium includes the following components: 0.4g/L (NH 4 ) 2 SO 4 , 5g/L sodium citrate, 0.01g/L NaCl, 0.05g/L MgSO 4 ·7H 2 O, 0.2g/L K 2 HPO 4 , 0.01g/L FeSO 4 ·7H 2 O, 0.01g/L MnSO 4 The pH of the heterotrophic nitrification medium is 7.0.
[0039] 16S rRNA gene of strain P5-2
[0040] Use the bacterial DNA extraction kit to extract the bacterial genomic DNA of the strain to be tested. Refer to the instructions for the specific operation steps. Use the extracted bacterial genomic DNA as a template to amplify the bacteria and amplify the primers for 16S rRNA:
[0041] 27F: 5'–GTTTGATCCTGGCTCAG–3';
[0042] 1492R: 5'–TACGGCTACCTTGTTACGACTT–3'.
[0043] The reaction system (25μL) is: template DNA 1μL, forward and reverse primers 0.5μL each, Mix 12.5μL, sterile distilled water 10.5μL, PCR amplification reaction conditions: 94℃3min; 94℃30s, 56℃30s, 72℃ 90s, 30 cycles; 72°C for 10 minutes. The PCR product was sent to Guangzhou Aiki Biotechnology Co., Ltd. for sequencing, and the sequence measured is shown in SEQ ID NO.1.
[0044] The strain has been deposited in the Guangdong Province Microbial Culture Collection Center on January 7, 2019. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City. The strain name: Bacillus megaterium P5- 2. The deposit number is GDMCC NO.60536.

Example Embodiment

[0045] Example 2
[0046] The isolated and purified Bacillus megaterium (Bacillus megaterium) P5-2 with high efficient denitrification, the colony morphology on LB solid medium is like figure 1 As shown, the Gram stain is positive ( figure 2 ); Hydrolyzable starch ( Figure 3-1 ) And casein ( Figure 3-2 );

Example Embodiment

[0047] Example 3
[0048] The safety of strain P5-2 to tilapia was tested by intraperitoneal injection and soaking. The results of the injection experiment showed that the concentration of 100μL injection of tilapia with a body weight of (6.5±1.5)g was 1.5×10 7 CFU/ml, 1.5×10 8 CFU/ml and 1.5×10 9 Under the condition of CFU/mL bacterial liquid, there was no death or other abnormal conditions; the immersion experiment results showed that the concentration of P5-2 in the water body was 1.5×10 6 CFU/mL and 1.5×10 7 In the case of CFU/mL, tilapia weighing (1.0±0.5)g did not die first and other abnormal phenomena. The above results indicate that P5-2 is a strain with good safety performance.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

no PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Similar technology patents

Waste heat furnace capable of adjusting sprayed urea and removing fly ash

ActiveCN112856445AGuaranteed denitrification effectGood denitrification effectGas treatmentEmission preventionSpray nozzleProcess engineering
Owner:上海域德环保工程有限公司

Classification and recommendation of technical efficacy words

  • Good denitrification effect
  • Fast growth

Aerobic denitrification methylobacterium phyllosphaerae and application thereof

ActiveCN102465103ABiologically active and stableGood denitrification effectBacteriaTreatment using aerobic processesChemistryNitrate nitrogen
Owner:CHINA PETROLEUM & CHEM CORP +1

Method for realizing short distance deep denitrogenation under low temperature

ActiveCN101264979AGood denitrification effectGood effect of energy saving and consumption reductionTreatment with aerobic and anaerobic processesEngineeringNitrogen
Owner:JIANGSU YULONG ENVIRONMENTAL PROTECTION

Biomembrane denitrification method for nitrogen containing sewage

ActiveCN106554079AHang film fastGood denitrification effectTreatment with aerobic and anaerobic processesEngineeringSewage treatment
Owner:CHINA PETROLEUM & CHEM CORP +1

Composite pig feed additive for preventing diarrhea of pigs

ActiveCN102524583AFast growthLower feed to meat ratioAnimal feeding stuffDiarrheaAnimal science
Owner:广西双胞胎饲料有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products