Gene cloning, vector construction and application of baical skullcap root anthocyanin transcriptional regulation factors SbMYB75 and SbDEL

A technology of transcriptional regulatory factors and anthocyanins, which is applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve many problems and achieve the effect of increasing anthocyanin production

Active Publication Date: 2019-06-28
SHANGHAI CHENSHAN BOTANICAL GARDEN
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Modern medicine shows that the main active ingredient in Scutellaria baicalensis is the flavonoids accumulated in the roots, and its MYB family and bHLH family have a significant effect on the regulation of flavonoids, but there are not many related studies on this
[0005] In recent years, there have been more and more studies on the transformation of various host cells to high-yield anthocyanins by using modern biotechnology methods such as genetic engineering and cell engineering. The method of determining the content of anthocyanins has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene cloning, vector construction and application of baical skullcap root anthocyanin transcriptional regulation factors SbMYB75 and SbDEL
  • Gene cloning, vector construction and application of baical skullcap root anthocyanin transcriptional regulation factors SbMYB75 and SbDEL
  • Gene cloning, vector construction and application of baical skullcap root anthocyanin transcriptional regulation factors SbMYB75 and SbDEL

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] This example is the cloning of SbMYB75 and the construction of the corresponding plant expression vector.

[0058] (1) Design and synthesis of SbMYB75 gene primers

[0059] Firstly, the transcriptome of Scutellaria baicalensis was deeply sequenced, and then the protein sequence of PAP1 gene of Arabidopsis thaliana was compared in the Scutellaria baicalensis transcriptome database, using the related sequences of related species reported in Arabidopsis and Labiatae plants as the standard, Part of the sequence of coding protein similarity > 60% was selected to obtain the relevant gene sequence in Scutellaria baicalensis, primer premier 5.0 was used to design the full-length primers, and Gateway recombination sites were added to the primers (Gateway recombination sites are underlined).

[0060] SbMYB75-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGAAAAGAAAGGTGAAGTAAAGAG (SEQ ID No. 5);

[0061] SbMYB75-R: GGGGACCACTTTGTACAAGAAAGCTGGGTT TTAACTCGAATAGGGACCTATGAG (SEQ ID No. 6);...

Embodiment 2

[0077] This example is the cloning of SbDEL and the construction of a binary plant expression vector containing both SbMYB75 and SbDEL.

[0078] (1) Design and synthesis of primers for SbDEL gene and CaMV35S promoter

[0079] Firstly, the transcriptome of Scutellaria baicalensis was deeply sequenced, and then the protein sequence of the DEL gene of Snapdragon was compared in the Scutellaria baicalensis transcriptome database, and the related sequences of related species reported in Arabidopsis and Labiatae plants were used as the standard to select Sequences with a partial coding protein similarity >60% were obtained to obtain related gene sequences in Scutellaria baicalensis, and primers were designed using primerpremier5.0 to design full-length primers, and the end sequence of the CaMV35S promoter was introduced before the upstream primer of SbDEL, and RsrII was introduced before the downstream primer Restriction sites and protective bases.

[0080] Using pK7WG2R as a templ...

Embodiment 3

[0108] In this example, a transgenic cell line containing SbMYB75, SbMYB75 and SbDEL was obtained by using the exogenous plant carrot.

[0109] Using the electric shock method, the plant expression vectors pK7WG2R-SbMYB75 and pK7WG2R-SbMYB75-SbDEL were transformed into A. rhizogenes A4 to obtain the expression vector containing SbMYB75 and the A. rhizogenes containing the binary expression vector of SbMYB75 and SbDEL respectively. At the same time, the empty plasmid containing the CaMV 35S promoter was transferred into the strain as a negative control.

[0110] Carrot seeds were routinely sterilized on the surface, placed in MS medium, and cultured under light at 25°C. After 30 days of cultivation, sterile carrot tissue culture seedlings can be obtained. Carrots were transformed by infecting leaf veins, and the infected leaves were placed on MS solid medium containing 50mM acetosyringone (AS), cultured in the dark at 25°C for 48-72h, and then transferred to medium containing ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a baical skullcap root anthocyanin transcriptional regulation factor, which comprises at least one of a SbMYB75 gene and a SbDEL gene, wherein a SbMYB75 gene sequence is shownas SEQ ID No.1, and a SbDEL gene sequence is shown as SEQ ID No.3. The invention also provides a primer composition for amplifying the above genes, a protein encoded by the genes, a recombinant vector, a recombinant microorganism, a host cell, a transgenic cell line or a transgenic plant tissue constructed by the above genes and an application thereof. Baical skullcap root anthocyanin transcription factors SbMYB75 and SbDEL and the recombinant vector constructed by the baical skullcap root anthocyanin transcription factors SbMYB75 and SbDEL are utilized to improve anthocyanin yield of the transgenic cell line. According to the gene cloning, vector construction and the application of the baical skullcap root anthocyanin transcriptional regulation factors SbMYB75 and SbDEL, the anthocyanin transcription factors SbMYB75 and SbDEL and encoded proteins thereof are cloned from baical skullcap root for the first time, the transgenic cell lines with high anthocyanin content are obtained through genetic engineering and cell engineering, and a solid foundation is laid for industrial improvement of the anthocyanin yield.

Description

technical field [0001] The invention relates to the field of genetic engineering of medicinal plants, in particular to gene sequences of baicalein anthocyanin transcription factors SbMYB75 and SbDEL and their constructed vectors and applications. Background technique [0002] Anthocyanin is a general term for a large class of flavonoids. It not only constitutes the colorful colors of nature, but also is widely used in the food field because of its strong antioxidant properties, especially health care products. The market demand is increasing and it has huge economic value. and market prospects. [0003] Both the MYB family and the bHLH family are transcription factor families that regulate the synthesis of flavonoids. Some transcription factors can promote anthocyanin synthesis and increase anthocyanin production in cells or in vitro. [0004] Scutellaria baicalensis is a kind of medicinal plant that has been used in my country for thousands of years. It is a perennial herb...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/11C12N15/82C12N5/10C07K14/415A01H5/00
Inventor赵清柳洁崔孟颖方誉民凯西·马丁
OwnerSHANGHAI CHENSHAN BOTANICAL GARDEN