Luciferase fluorescence-complementary system, and preparation method and application thereof

A luciferase and system technology, applied in the field of biochemistry, can solve the problems of limited dual fluorescence complementary technology, poor efficiency of dual fluorescence complementary technology, etc.

Active Publication Date: 2019-07-02
SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The biggest difficulty of dual fluorescence complementary technology is that the efficiency of spatial self-assembly to form fluorescent complementary is too low, which greatly limits the practical application of dual fluorescent complementary technology.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Luciferase fluorescence-complementary system, and preparation method and application thereof
  • Luciferase fluorescence-complementary system, and preparation method and application thereof
  • Luciferase fluorescence-complementary system, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1 Protein pair SidM / DrrA and preparation of Rab1 fragment and Gaussia luciferase fragment fusion gene expression vector

[0068] The preparation method of the fusion gene expression vector is as follows:

[0069] (1) The luciferase N-terminal fragment NGluc was introduced at the C-terminal of Rab1, and a flexible long peptide chain linker (GGGGS) was introduced between the two 2 , and introduce a purification tag His6 tag at the C-terminus of the fusion;

[0070] The PCR reaction system is: 25 μL 2×Taq Master Mix, 1 μL DNA template pCDNA3.1-Rab1-linker-NGluc, 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), and supplemented with water to 50 μL;

[0071] The primers used to introduce the luciferase N-terminal fragment NGluc at the C-terminal of Rab1 are:

[0072] The sequence of the upstream primer SEQ ID NO:1 is:

[0073] 5'AAACGGATCTCTAGCGAATTCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACTACAAGGACGAGAACCCCCGAGTACGACTACCT ...

Embodiment 2

[0091] Compared with Example 1, except that the luciferase C-terminal fragment Cgluc is introduced at the C-terminus of SidM / DrrA, other conditions are the same as in Example 1;

[0092] The PCR reaction system is: 25 μL 2×Taq Master Mix, 1 μL DNA template SidM / DrrA-linker-CGluc, 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), and supplemented with water to 50 μL;

[0093] The primers used to introduce the C-terminal fragment CGluc at the C-terminal of SidM / DrrA are:

[0094] The upstream primer SEQ ID NO:7 is as follows:

[0095] 5'AAACGGATCTCTAGCGAATTCGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACTACAAGGACGAG CCCTACAGCGACGCTAAGG 3';

[0096] The downstream primer SEQ ID NO:8 is as follows:

[0097] 5'GAGGTCGAGGTCGGGGGATCCTTAATGGTGATGGTGATGATGGTCACCACCGGCCCCCTTGATCTT 3'.

Embodiment 3

[0098] Example 3 Recovery and Subculture of HEK293F Cells

[0099] Quickly take out the HEK293F cell line from the liquid nitrogen tank to revive the cells, put them in a 37°C water bath and shake slowly until they melt, transfer the cells into a centrifuge tube in an ultra-clean bench, centrifuge at 1000rpm for 5min, discard the supernatant, and lightly shake it with your fingers. Pop the bottom of the centrifuge tube to disperse the cells, add 2mL of medium, and gently blow the cells with a pipette gun to disperse the cells; transfer the cells to a shake flask, and add HEK293F basal culture to culture in a carbon dioxide incubator;

[0100] After 2 days, observe the growth of the cells and count them under the microscope. If the cell density reaches 2-3×10 6 cells / mL, it means that the cells enter the logarithmic growth phase and should be subcultured;

[0101] Use a pipette to gently blow the cell suspension cultured in the shake flask and quickly transfer it to a centrifu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a luciferase fluorescence-complementary system as well as a preparation method and application thereof. The luciferase fluorescence-complementary system comprises Rab1, SidM / DrrA, a luciferase C-terminal, a luciferase N-terminal, linker peptides and a reducer TCEP; the C terminal of the Rab1 is connected with the luciferase N-terminal by a linker peptide; and the SidM / DrrA is connected with a luciferase C-terminal fragment by a linker peptide. By introducing specific interaction protein pairs, designing appropriate flexible peptides and binding sites as well as optimizing type and concentration of a reducer in a buffer solution, the luciferase fluorescence-complementary system finally has significantly increased fluorescence complementary efficiency; and the fluorescence complementary efficiency can be increased to up to 30 times. Moreover, the preparation method of the luciferase fluorescence-complementary system provided by the invention is simple and highly efficient, so that, the preparation method is convenient to operate, easy to promote, wide in application prospects and high in market values.

Description

technical field [0001] The invention relates to the field of biochemistry, in particular to a luciferase fluorescence complementary system and its preparation method and application. Background technique [0002] With the in-depth study of subcellular structure and function, molecular physiology and pathology, and intercellular and intracellular signaling pathways, human beings' understanding of diseases and the essence of life has been traced back to the level of proteins and genes. Many life activities are realized by the combination and dissociation of protein molecules. Various important physiological activities of cells, the response of cells to the external environment and internal environment, etc., are all based on protein-protein interaction. , PPIs) as a link to form a signal transduction network system. Therefore, an in-depth study of the interactions between proteins is a necessary prerequisite for the recognition and understanding of various life phenomena. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/66G01N21/64G01N33/68C12N15/52C12N15/85
CPCC12Q1/66G01N21/6486G01N33/68C12N15/52
Inventor 金宗文袁静杨偲罗擎颖朱海袁克湖付辉
Owner SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products