Hybridoma cell line and antibody produced therewith and preparation method
A hybridoma cell line and monoclonal antibody technology, applied in the field of bioengineering, can solve the problems of genetically modified food producing allergens, food toxicity, and food nutritional value changes.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Embodiment 1 Hybridoma cell acquisition and preparation of monoclonal antibody thereof
[0030] 1. Preparation of immune antigen
[0031] 1.1 Construction of recombinant protein Cry2A expression strain, cell culture and lysis
[0032] Amplification of Cry2A-encoding gene: using transgenic rice T1C-19 genomic DNA as template, Cry2A-NdeI-F: catatgaacaacgtgctgaacagc and Cry2A-XhoI-R: ctcgagttagtagagtggcggcag as primers, PCR amplification with high-fidelity Fastpfu, the amplified PCR product After identification by (1.0%) agarose gel electrophoresis, the target band was recovered by cutting the gel, recovered with Universal DNA Purification and Recovery Kit (Tiangen), and the recovered product was digested with restriction enzymes Nde I and Xho I, The pET28a plasmid fragment recovered by the gel and subjected to the same digestion and gel recovery was ligated overnight at 4°C, transformed into Trans10 competent cells (Beijing Quanshijin), and the clones were picked for col...
Embodiment 2
[0064] Example 2 Subclass identification and titer determination of monoclonal antibodies
[0065] The purified monoclonal antibody was tested by ELISA with the standard anti-BALB / c mouse IgG1, IgG2a, IgG2b, IgG3, and IgM antibodies from sigma company. The test results showed that the monoclonal antibody type was IgG2b, and the recombinant protein Cry2A was used as the antigen. The ELISA method was used to detect the titer of the purified monoclonal antibody by Figure 4 It can be seen that the titer of the purified 1D11 1A5 monoclonal antibody was 1:768000 as determined by ELISA; Figure 5 It can be seen that the titer of the purified 2G4 1B8 monoclonal antibody was 1:640000 as determined by ELISA.
[0066] Table 2 Concentration and subtype of monoclonal antibody produced by hybridoma cell line 1D11 1A5
[0067] Monoclonal antibody hybridoma cell number Antibody (IgG) Concentration Antibody isotype 1D11 1A5 3.0mg / mL IgG2a
[0068] Table 3 Concent...
Embodiment 3
[0070] Example 3 Monoclonal Antibody Specific Detection
[0071] The endogenous proteins of transgenic rice and its transformed parents were extracted respectively, run on SDS-PAGE gel, and purified monoclonal antibodies (1D11 1A5 and 2G4 1B8) were used as primary antibodies for membrane transfer, Alexa FluorTM 680goat anti-mouse IgG (H+L) (Invitrogen ) is the secondary antibody, and the result is detected by Odyssey infrared740imager (9120, Li-CORBiosciences, Lincoln, NE) infrared scanner western, by Figure 6 It can be seen that the purified 1D11 1A5 monoclonal antibody can specifically recognize Cry2A and recombinant protein Cry2A in endogenous samples; Figure 7 It can be seen that the purified 2G4 1B8 monoclonal antibody can specifically recognize Cry2A and recombinant protein Cry2A in endogenous samples.
[0072] Wherein, transgenic rice protein extraction method:
[0073] Quick-freeze the tissue in liquid nitrogen, grind it, add 1mL (according to the sample size, gene...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


