Unlock instant, AI-driven research and patent intelligence for your innovation.

Hybridoma cell line and antibody produced therewith and preparation method

A hybridoma cell line and monoclonal antibody technology, applied in the field of bioengineering, can solve the problems of genetically modified food producing allergens, food toxicity, and food nutritional value changes.

Active Publication Date: 2021-09-28
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although genetically modified food can meet people's requirements for yield, insect resistance, etc., it also brings some potential threats to human life. , causing people to develop drug resistance, changing the nutritional value of food, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hybridoma cell line and antibody produced therewith and preparation method
  • Hybridoma cell line and antibody produced therewith and preparation method
  • Hybridoma cell line and antibody produced therewith and preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1 Hybridoma cell acquisition and preparation of monoclonal antibody thereof

[0030] 1. Preparation of immune antigen

[0031] 1.1 Construction of recombinant protein Cry2A expression strain, cell culture and lysis

[0032] Amplification of Cry2A-encoding gene: using transgenic rice T1C-19 genomic DNA as template, Cry2A-NdeI-F: catatgaacaacgtgctgaacagc and Cry2A-XhoI-R: ctcgagttagtagagtggcggcag as primers, PCR amplification with high-fidelity Fastpfu, the amplified PCR product After identification by (1.0%) agarose gel electrophoresis, the target band was recovered by cutting the gel, recovered with Universal DNA Purification and Recovery Kit (Tiangen), and the recovered product was digested with restriction enzymes Nde I and Xho I, The pET28a plasmid fragment recovered by the gel and subjected to the same digestion and gel recovery was ligated overnight at 4°C, transformed into Trans10 competent cells (Beijing Quanshijin), and the clones were picked for col...

Embodiment 2

[0064] Example 2 Subclass identification and titer determination of monoclonal antibodies

[0065] The purified monoclonal antibody was tested by ELISA with the standard anti-BALB / c mouse IgG1, IgG2a, IgG2b, IgG3, and IgM antibodies from sigma company. The test results showed that the monoclonal antibody type was IgG2b, and the recombinant protein Cry2A was used as the antigen. The ELISA method was used to detect the titer of the purified monoclonal antibody by Figure 4 It can be seen that the titer of the purified 1D11 1A5 monoclonal antibody was 1:768000 as determined by ELISA; Figure 5 It can be seen that the titer of the purified 2G4 1B8 monoclonal antibody was 1:640000 as determined by ELISA.

[0066] Table 2 Concentration and subtype of monoclonal antibody produced by hybridoma cell line 1D11 1A5

[0067] Monoclonal antibody hybridoma cell number Antibody (IgG) Concentration Antibody isotype 1D11 1A5 3.0mg / mL IgG2a

[0068] Table 3 Concent...

Embodiment 3

[0070] Example 3 Monoclonal Antibody Specific Detection

[0071] The endogenous proteins of transgenic rice and its transformed parents were extracted respectively, run on SDS-PAGE gel, and purified monoclonal antibodies (1D11 1A5 and 2G4 1B8) were used as primary antibodies for membrane transfer, Alexa FluorTM 680goat anti-mouse IgG (H+L) (Invitrogen ) is the secondary antibody, and the result is detected by Odyssey infrared740imager (9120, Li-CORBiosciences, Lincoln, NE) infrared scanner western, by Figure 6 It can be seen that the purified 1D11 1A5 monoclonal antibody can specifically recognize Cry2A and recombinant protein Cry2A in endogenous samples; Figure 7 It can be seen that the purified 2G4 1B8 monoclonal antibody can specifically recognize Cry2A and recombinant protein Cry2A in endogenous samples.

[0072] Wherein, transgenic rice protein extraction method:

[0073] Quick-freeze the tissue in liquid nitrogen, grind it, add 1mL (according to the sample size, gene...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses hybridoma cell strains 1D11 1A5 and 2G4 1B8, antibodies produced therefrom and a preparation method thereof. The hybridoma cell line was deposited in the General Microbiology Center of China Microbiological Culture Collection Management Committee on November 08, 2018, and the preservation numbers are CGMCC No.16696 and CGMCC No.16695. The antibody indirect ELISA titers obtained after the purification of ascites secreted monoclonal antibody by the cell line were 1:768000 and 1:640000 respectively, and the antibody subtypes were IgG2a and IgG1 respectively. The monoclonal antibody can specifically recognize the recombinant Cry2A protein and The endogenous Cry2A protein in transgenic rice provides material and technical support for the detection of this protein in transgenic rice.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to hybridoma cell lines 1D11 1A5 and 2G41B8, antibodies produced therefrom and a preparation method thereof. Background technique [0002] Bacillus thuringiensis (Bt) is a widespread Gram-positive bacterium, and the insect-resistant crystal protein secreted by the bacteria is currently the main biological pesticide; the secreted insect-resistant protein is divided into two types according to the similarity of amino acid sequence : Cry and Cry delta-endotoxin. Among them, the Cry protein is toxic to the larvae of various harmful insects (such as Lepidoptera, Diptera, Coleoptera, nematodes and protists, etc.). Cry toxins have been introduced into crops to make them resistant to insects. Cry2A protein is one of the Cry toxins. At present, the crops with Cry gene mainly include corn, potato, rice, cotton and so on. [0003] The development and progress of transgenic technolog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/20C07K16/12G01N33/569C12R1/91
CPCC07K16/1278G01N33/56911C07K2317/35
Inventor 刘卫晓金芜军张哲高进董美王迪
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI