Unlock instant, AI-driven research and patent intelligence for your innovation.

Engineering bacterium over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof

A technology of transcription inhibitors and genetically engineered bacteria, which is applied in the fields of genetic engineering and microbial fermentation engineering, can solve the problems of unclear regulation mechanism and low flocculation activity of biological flocculants, and achieve the effects of reducing costs, improving flocculation activity, and increasing production

Active Publication Date: 2019-07-19
XIAMEN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The first purpose of the present invention is to provide an overexpressed carbon catabolite repression effect transcriptional repressor gene (ccpN) for the problems of low flocculation activity and unclear regulation mechanism of biological flocculants in the prior art.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacterium over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof
  • Engineering bacterium over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof
  • Engineering bacterium over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1: the construction of recombinant expression vector PHY300-ccpN

[0031] Design PCR primers for amplifying the ccpN gene fragment.

[0032] The upstream and downstream primers are:

[0033] Upstream primer: CG ACTAGT CTACATGATTTCATTTTCAGATAAGCCGAC (the underline is the SpeI restriction site)

[0034] Downstream primer: TG GGTACC TTGCAGATTGTCAAAAGAGAAC (the underline is the KpnI restriction site)

[0035] Using Bacillus licheniformis CGMCC 2876 genomic DNA as a template, perform the following PCR program: (1) 94°C, 5min; (2) 94°C, 30s; (3) 63°C, 30s; (4) 72°C, 1min, step (2) )~(4) Repeat 35 cycles; (5) 72°C, 10min, 4°C storage.

[0036] The PCR reaction system is shown in Table 1.

[0037] Table 1

[0038]

[0039] The PCR product and the expression vector PHY300PLK-PamyL-TTamyL were double-digested with restriction endonucleases Kpn I and SpeI respectively. After recovery, the PCR product and the expression vector were ligated at a ratio of 3:1 w...

Embodiment 2

[0040] Embodiment 2: the construction of bacillus licheniformis genetically engineered bacteria HN301-6

[0041] After the PHY300-ccpN overexpression plasmid was extracted and concentrated, it was transformed into Bacillus licheniformis by electric shock, recovered at 37°C for 5 hours, coated with a tetracycline-resistant plate, and cultured at 37°C for 12 hours to screen transformants. After the transformant was extracted from the plasmid, it was verified by colony PCR and double enzyme digestion (such as figure 1 ). Thus, the Bacillus licheniformis engineering strain HN301-6 overexpressing the carbon catabolite repression effect transcriptional repressor gene ccpN was obtained.

[0042] The specific steps of electroconversion are as follows:

[0043] 1) Preparation of Bacillus licheniformis competent:

[0044] (1) Inoculate a loop of B.licheniformis in 50mL LB medium, 37°C, 200r min -1 Cultivate overnight for 12 hours;

[0045] (2) Take 1 mL of the overnight culture sol...

Embodiment 3

[0054] Embodiment 3: Utilize Bacillus licheniformis and its genetically engineered bacteria fermentation to prepare polysaccharide flocculant

[0055] Inoculate the Bacillus licheniformis CGMCC 2876 starting strain and the genetically engineered bacterium described in Example 2 in the liquid seed culture medium, cultivate it at 200r / min for 16h at 37°C, prepare the seed culture solution, and inoculate with an inoculum size of 4% by volume percentage In the polysaccharide flocculant fermentation medium, cultivate at 37°C and 200r / min, and carry out the experiment of producing polysaccharide flocculant by fermentation. After 56 hours, the flocculation activity of the fermentation broth and the production of the polysaccharide flocculant (such as figure 2 ). The final flocculation activity of the fermentation broth of recombinant genetically engineered bacteria overexpressed with ccpN gene was 5973.33 U·mL -1 , the final flocculation activity of the fermentation broth of the o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an engineering bacterium over-expressing carbon catabolite repression effect transcription inhibitor gene and a construction method thereof. The over-expressed carbon catabolite repression effect transcription inhibitor gene ccpN is obtained by cloning polysaccharide flocculant by using PCR amplification in a synthesis pathway, the nucleotide sequence is as shown in SEQ IDNo.1. The carbon catabolite repression effect transcription inhibitor gene ccpN is cloned by using PCR amplification, the gene ccpN fragment are ligated into an expression vector, and introduced intoBacillus licheniformis, and the engineering bacterium of the target gene is obtained by tetracycline resistance screening. The construction method is as follows: designing PCR primers; inserting thetarget gene into downstream multiple cloning sites of PHY300PLK-PamyL-TTamyL constitutive promoter PamyL so as to obtain expression plasmids, and introducing the plasmids into escherichia coli DH5alpha for amplification; and transferring the over-expressed plasmids by electric shock into the Bacillus licheniformis, selecting transformants, and performing verification to obtain recombinant bacteriaof Bacillus licheniformis.

Description

technical field [0001] The invention relates to genetic engineering and microbial fermentation engineering, in particular to an engineering bacterium overexpressing a carbon catabolite repression effect transcription inhibitor gene and a construction method thereof. Background technique [0002] The phenomenon that bacteria preferentially utilize one (usually glucose) in an environment where multiple carbon sources coexist is called catabolite repression (CCR). The carbon control protein CcpN is a central regulatory protein of carbon metabolism in cells, which mainly regulates central carbon metabolism by inhibiting gluconeogenesis genes (gapB, pckA) and glycerol degradation pathways (glpFK, glpD) (Bioscience, biotechnology, and biochemistry, 2009, 73(2):245-259; Journal of Biotechnology, 2002, 184(15):4288-4295). It is also a transcriptional repressor of carbon catabolite repression in Gram-positive bacteria, especially Bacillus spp. The effect is more obvious (Molecular ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/75C12P19/04C12R1/10
CPCC07K14/32C12N15/75C12P19/04
Inventor 何宁王玲伟
Owner XIAMEN UNIV