Engineering bacterium over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof
A technology of transcription inhibitors and genetically engineered bacteria, which is applied in the fields of genetic engineering and microbial fermentation engineering, can solve the problems of unclear regulation mechanism and low flocculation activity of biological flocculants, and achieve the effects of reducing costs, improving flocculation activity, and increasing production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Embodiment 1: the construction of recombinant expression vector PHY300-ccpN
[0031] Design PCR primers for amplifying the ccpN gene fragment.
[0032] The upstream and downstream primers are:
[0033] Upstream primer: CG ACTAGT CTACATGATTTCATTTTCAGATAAGCCGAC (the underline is the SpeI restriction site)
[0034] Downstream primer: TG GGTACC TTGCAGATTGTCAAAAGAGAAC (the underline is the KpnI restriction site)
[0035] Using Bacillus licheniformis CGMCC 2876 genomic DNA as a template, perform the following PCR program: (1) 94°C, 5min; (2) 94°C, 30s; (3) 63°C, 30s; (4) 72°C, 1min, step (2) )~(4) Repeat 35 cycles; (5) 72°C, 10min, 4°C storage.
[0036] The PCR reaction system is shown in Table 1.
[0037] Table 1
[0038]
[0039] The PCR product and the expression vector PHY300PLK-PamyL-TTamyL were double-digested with restriction endonucleases Kpn I and SpeI respectively. After recovery, the PCR product and the expression vector were ligated at a ratio of 3:1 w...
Embodiment 2
[0040] Embodiment 2: the construction of bacillus licheniformis genetically engineered bacteria HN301-6
[0041] After the PHY300-ccpN overexpression plasmid was extracted and concentrated, it was transformed into Bacillus licheniformis by electric shock, recovered at 37°C for 5 hours, coated with a tetracycline-resistant plate, and cultured at 37°C for 12 hours to screen transformants. After the transformant was extracted from the plasmid, it was verified by colony PCR and double enzyme digestion (such as figure 1 ). Thus, the Bacillus licheniformis engineering strain HN301-6 overexpressing the carbon catabolite repression effect transcriptional repressor gene ccpN was obtained.
[0042] The specific steps of electroconversion are as follows:
[0043] 1) Preparation of Bacillus licheniformis competent:
[0044] (1) Inoculate a loop of B.licheniformis in 50mL LB medium, 37°C, 200r min -1 Cultivate overnight for 12 hours;
[0045] (2) Take 1 mL of the overnight culture sol...
Embodiment 3
[0054] Embodiment 3: Utilize Bacillus licheniformis and its genetically engineered bacteria fermentation to prepare polysaccharide flocculant
[0055] Inoculate the Bacillus licheniformis CGMCC 2876 starting strain and the genetically engineered bacterium described in Example 2 in the liquid seed culture medium, cultivate it at 200r / min for 16h at 37°C, prepare the seed culture solution, and inoculate with an inoculum size of 4% by volume percentage In the polysaccharide flocculant fermentation medium, cultivate at 37°C and 200r / min, and carry out the experiment of producing polysaccharide flocculant by fermentation. After 56 hours, the flocculation activity of the fermentation broth and the production of the polysaccharide flocculant (such as figure 2 ). The final flocculation activity of the fermentation broth of recombinant genetically engineered bacteria overexpressed with ccpN gene was 5973.33 U·mL -1 , the final flocculation activity of the fermentation broth of the o...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com