Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant herpes simplex virus carrying fluorescent Timer gene capable of discoloring, preparation method and application thereof

A herpes simplex virus and color-changing technology, which is applied in the field of anti-virus, analysis of virus replication and pathogenic mechanism, and establishment of infection model, can solve the problems of inability to distinguish virus time and increase time dimension, and achieve a wide range of hosts and abundant expression high degree of effect

Pending Publication Date: 2019-07-19
WUHAN INST OF PHYSICS & MATHEMATICS CHINESE ACADEMY OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, all current cross-multisynapse tool virus markers cannot distinguish the time required for each level of synapse crossing of the virus. In order to increase the consideration parameters in the time dimension, we designed to introduce a time-dependent color-changing fluorescent timer gene into the HSV tool virus. Construction of herpes simplex virus that can change color over time and applied to neural network tracing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant herpes simplex virus carrying fluorescent Timer gene capable of discoloring, preparation method and application thereof
  • Recombinant herpes simplex virus carrying fluorescent Timer gene capable of discoloring, preparation method and application thereof
  • Recombinant herpes simplex virus carrying fluorescent Timer gene capable of discoloring, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Codon Optimization and Gene Synthesis of a Novel Fluorescent Timer Gene (laRFP) from Amphioxus

[0049] In 2013, Russian scientists isolated a new red fluorescent protein laRFP from amphioxus, and its mutant laRFP-ΔS83 is a unique new fluorescent Timer gene, whose sequence is shown in SEQ ID NO.1. We designed and constructed the novel fluorescent Timer gene into the herpes simplex virus genome of the anterograde trans-synaptic tracer tool virus, and recombined to obtain a time-dependent, color-changing new HSV tool virus. Before constructing the targeting vector, we first analyzed the original gene sequence of lanRFP-ΔS83. Since amphioxus belongs to chordates and has a long genetic distance from higher mammals in evolution, we optimized the full-length codon-modified gene sequence of laRFP. laRFP, cmlaRFP), to ensure high-abundance expression and post-translational modification and maturation in mammalian cells, especially neurons. The optimized cmlaRFP gene sequence is...

Embodiment 2

[0051] Homology arm cloning and targeting vector construction containing cmlanRFP

[0052] ①Homologous arm cloning: extract and purify the HSV-1H129 viral genomic DNA, and use it as a template to clone the 1460bp homologous arm sequence of the UL37 gene. The primers used are UL37-F: 5'CCCAAGCTTGTCGGGATCAAACACGGCCACGTCC 3'; '(introduce BamHI, AgeI, HpaI endonuclease sites); clone UL38 gene homology arm sequence 1506bp, the primer used is UL38-F: 5'GGCGGATCCTGCAGGCGGGTCTTGCTAGGTCGCGATCTGG 3'(introduce BamHI, SbfI, NruI endonuclease sites); UL38-R: 5'GGCGAATTCCGGGTCAACGAACAACGAGTGACAG 3'; the cloned UL37 and UL38 gene homology arm fragments were digested by Hind III, BamH I, BamH I, and EcoR I respectively, and then ligated into the pcDNA3.1+ vector, named pH129 UL37-38 , in which a multiple cloning site is introduced in the middle of the homology arm, that is, HpaI, AgeI, BamHI, SbfI, and NruI multiple enzyme cutting sites, which are convenient for subsequent molecular cloning e...

Embodiment 3

[0056] Recombination and purification of recombinant herpes simplex virus carrying fluorescent Timer gene with variable color

[0057] ① Virus recombination: extraction targeting carrier pH129 UL37-38 -hUbC-cmLaRFP-WPRE-PA transfected 293T cells by liposome transfection, replaced the maintenance medium containing 2% FBS in 6 hours and added herpes simplex virus H129 strain for infection; observed the expression of fluorescence and In the case of cell lesions, the cell culture supernatant was collected after all the cells were lesions and placed in a -80°C refrigerator.

[0058]②Purification of the virus: The collected virus supernatant was frozen and thawed three times, centrifuged at 6500g for 10 minutes to remove cell debris, and 10 μl of the virus supernatant was taken to infect Vero cells. After 1 day, the infected cells were observed for fluorescent expression to determine whether the new virus was recombined. Success; in the later stage, take the successfully recombined...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant herpes simplex virus carrying fluorescent Timer gene capable of discoloring, a preparation method and an application thereof. The recombinant herpes simplex virusprepared by the invention changes the fluorescence timer from green to red in time during the HSV cross multisynaptic loop tracing, which provides important consideration in the time dimension for the real-time study of viral transsynaptic tracing, so that neurons infected with virus at different times can be distinguished by the fluorescent color differences, so that the link series of labeled neural network and the initial infected area can be indirectly obtained. The recombinant herpes simplex virus carrying the fluorescent Timer gene capable of discoloring has a wide range of applicationson neural loop marker, virus-infected cell process, animal infection model establishment, virus replication and pathogenic mechanism analysis, and antiviral drug screening in the time-space dimension.

Description

technical field [0001] The invention belongs to the field of biotechnology, generally relates to neurobiology and virology, and more specifically relates to the construction and preparation of a color-changing recombinant herpes simplex virus carrying a fluorescent Timer gene, and the neural circuit of the recombinant herpes simplex virus in the space-time dimension Marking, establishment of animal infection models, analysis of virus replication and pathogenic mechanisms, screening of antiviral drugs, etc. Background technique [0002] The brain is the most complex organ in the human body. Studying the structure of neural circuits is an important basis for understanding the working mechanism of the brain and treating brain diseases. Correspondingly, it is necessary to establish tracing tools and methods for efficiently tracing the structure of neural circuits. Traditional compound tracers (such as FluoroGold, PHAL, etc.) can only mark the morphology of local neurons, but can...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/66C12N15/12C12N7/01G01N21/64G01N1/28G01N1/42C12R1/93
CPCC12N15/85C12N15/66C12N7/00C07K14/43504G01N21/6458G01N1/286G01N1/42C12N2710/16621C12N2710/16652C12N2800/22C12N2800/107G01N2001/2873
Inventor 王华东徐富强夏金金苏鹏李颖利林坤章
Owner WUHAN INST OF PHYSICS & MATHEMATICS CHINESE ACADEMY OF SCI