Recombinant herpes simplex virus carrying fluorescent Timer gene capable of discoloring, preparation method and application thereof
A herpes simplex virus and color-changing technology, which is applied in the field of anti-virus, analysis of virus replication and pathogenic mechanism, and establishment of infection model, can solve the problems of inability to distinguish virus time and increase time dimension, and achieve a wide range of hosts and abundant expression high degree of effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Codon Optimization and Gene Synthesis of a Novel Fluorescent Timer Gene (laRFP) from Amphioxus
[0049] In 2013, Russian scientists isolated a new red fluorescent protein laRFP from amphioxus, and its mutant laRFP-ΔS83 is a unique new fluorescent Timer gene, whose sequence is shown in SEQ ID NO.1. We designed and constructed the novel fluorescent Timer gene into the herpes simplex virus genome of the anterograde trans-synaptic tracer tool virus, and recombined to obtain a time-dependent, color-changing new HSV tool virus. Before constructing the targeting vector, we first analyzed the original gene sequence of lanRFP-ΔS83. Since amphioxus belongs to chordates and has a long genetic distance from higher mammals in evolution, we optimized the full-length codon-modified gene sequence of laRFP. laRFP, cmlaRFP), to ensure high-abundance expression and post-translational modification and maturation in mammalian cells, especially neurons. The optimized cmlaRFP gene sequence is...
Embodiment 2
[0051] Homology arm cloning and targeting vector construction containing cmlanRFP
[0052] ①Homologous arm cloning: extract and purify the HSV-1H129 viral genomic DNA, and use it as a template to clone the 1460bp homologous arm sequence of the UL37 gene. The primers used are UL37-F: 5'CCCAAGCTTGTCGGGATCAAACACGGCCACGTCC 3'; '(introduce BamHI, AgeI, HpaI endonuclease sites); clone UL38 gene homology arm sequence 1506bp, the primer used is UL38-F: 5'GGCGGATCCTGCAGGCGGGTCTTGCTAGGTCGCGATCTGG 3'(introduce BamHI, SbfI, NruI endonuclease sites); UL38-R: 5'GGCGAATTCCGGGTCAACGAACAACGAGTGACAG 3'; the cloned UL37 and UL38 gene homology arm fragments were digested by Hind III, BamH I, BamH I, and EcoR I respectively, and then ligated into the pcDNA3.1+ vector, named pH129 UL37-38 , in which a multiple cloning site is introduced in the middle of the homology arm, that is, HpaI, AgeI, BamHI, SbfI, and NruI multiple enzyme cutting sites, which are convenient for subsequent molecular cloning e...
Embodiment 3
[0056] Recombination and purification of recombinant herpes simplex virus carrying fluorescent Timer gene with variable color
[0057] ① Virus recombination: extraction targeting carrier pH129 UL37-38 -hUbC-cmLaRFP-WPRE-PA transfected 293T cells by liposome transfection, replaced the maintenance medium containing 2% FBS in 6 hours and added herpes simplex virus H129 strain for infection; observed the expression of fluorescence and In the case of cell lesions, the cell culture supernatant was collected after all the cells were lesions and placed in a -80°C refrigerator.
[0058]②Purification of the virus: The collected virus supernatant was frozen and thawed three times, centrifuged at 6500g for 10 minutes to remove cell debris, and 10 μl of the virus supernatant was taken to infect Vero cells. After 1 day, the infected cells were observed for fluorescent expression to determine whether the new virus was recombined. Success; in the later stage, take the successfully recombined...
PUM
Property | Measurement | Unit |
---|---|---|
Titer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap