Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Biological sensing chip capable of circularly detecting trace uranyl ions and preparation method and application method of chip

A cycle detection and biosensing technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of low sensitivity and selectivity, and achieve low sensitivity and selectivity, good selectivity, The effect of high-sensitivity and rapid detection

Pending Publication Date: 2019-08-09
INST OF CHEM MATERIAL CHINA ACADEMY OF ENG PHYSICS
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The invention can detect uranyl ion ultrasensitively, and can detect the concentration as low as 1.0×10 -12 The uranyl ion of M effectively solves the problem of low sensitivity and selectivity of existing detection techniques

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological sensing chip capable of circularly detecting trace uranyl ions and preparation method and application method of chip
  • Biological sensing chip capable of circularly detecting trace uranyl ions and preparation method and application method of chip
  • Biological sensing chip capable of circularly detecting trace uranyl ions and preparation method and application method of chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1) preparing the DNAzyme biosensing SERS chip of the present invention;

[0038] First prepare PS microsphere template, grow ZnO on the template, use magnetron sputtering to prepare ZnO-Ag composite material, use the prepared ZnO-Ag composite material substrate as SERS substrate, put the SERS substrate in a centrifuge tube, add Enzyme chain solution (concentration: 0.001M), so that the solution is immersed in the SERS substrate, the enzyme chain DNA:

[0039] RhBCCCCGCTCAAGTCTGGATTACACGTCCATCTCTGCAGTCGGGTAG TTAAACCGACCTTCAGACATAGTGAGTAAGCCTTT 5'-3'.

[0040] Place the centrifuge tube in a constant temperature mixer, 350 rpm, 25°C constant temperature, and react for 24 hours to make the DNA terminal sulfhydryl group covalently form silver-sulfur bonds with silver nanoparticles, and self-assemble on the surface of the SERS substrate to form a monomolecular layer . Then add 1 M saline solution to the solution five times every 2 hours, so that the final concentration of NaC...

Embodiment 2

[0044] Embodiment 2 The DNAzyme biosensing SERS chip of the present invention detects different metal ions at the same concentration:

[0045] Utilize the DNAzyme biosensing SERS chip described in embodiment one to soak respectively in the same concentration (10 -9 M) of different heavy metal ions (such as Ag + , Mg 2+ , Fe 3+ , Ca 2+ , Fe 2+ 、Co 2+ 、Ni 2+ 、Cd 2+ , Hg 2+ , Pb 2+ 、Th 4+ 、Ba 2+ , Mn 2+ ) solution for 10 minutes for Raman detection. Figure 4 It is a diagram of the test result of interfering ions in Example 2 of the present invention. Depend on Figure 4 It can be seen that the Raman spectrum of uranyl ion is significantly enhanced compared with other ion solutions, from Figure 4 It can be seen in the corresponding Raman peak 1366cm -1 The intensity of the chip can be used to quantitatively compare the differences between different ions, and the results show that the chip has good specificity and can accurately identify uranyl ions in the actual ...

Embodiment 3

[0046] Embodiment 3: Reconstruction and recycling test of the chip of the present invention

[0047] 1. If figure 1 As shown, the reconstruction of the biochip of the present invention is after a detection, the chip is washed with PBS to remove residual DNA and uranyl ions, the chip is taken out, and mixed with the substrate chain dissolved in the hybridization buffer at a constant temperature Mix and incubate at 37°C for 24 hours in the instrument, substrate strand concentration: 0.001M, substrate strand DNA:

[0048] AAAGGCTTTTAATCACTCACTTrAGGAAGAGATGGACGTGTAATCCAGACTTGAGCGGG 5'-3', rA (ribonucleotide adenosine) represents the base A in ribonucleotide;

[0049] The DNA double-stranded structure was formed by DNA complementary pairing, then washed several times with PBS buffer, dried with nitrogen, and reconstructed to obtain the DNAzyme biosensing SERS chip ( Figure 5 ). In the above process, the pH value can be selected as 6.88.

[0050] 2. The recycling experiment of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a biological sensing chip capable of circularly detecting trace uranyl ions and a preparation method and application method of the chip. The chip consists of a ZnO-Ag compositematerial substrate, a nucleotide sequence and sequence fragments of a 5'-end coupled sulfhydryl group and a 3'-end coupled fluorescent dye RhB. The chip is composed of a composite material and a biological sensing probe, DNAzyme covalently connected to the chip can achieve specific response to uranyl ions, and the biological activity is activated, so that a substrate chain is broken into two freeDNA sections to modify fluorescent molecules on one DNA section; since the DNA sequence is broken and DNAs fall onto the surface of an SERS substrate, stronger SERS signals can be detected, and higher sensitivity, specificity and reproducibility can be achieved. Meanwhile, by repairing the broken sequence, the biological sensing probe can be circularly used to achieve the purposes of high-efficiency detection and cost reduction.

Description

technical field [0001] The present invention relates to a biosensing chip capable of recyclably detecting trace uranyl ions. More specifically, the present invention relates to a biosensing chip and method for detecting trace uranyl ions based on recyclable biosensors, which belong to water environment The field of detection of trace ions. Background technique [0002] As we all know, uranium is an important natural radioactive element, which plays an important role in the field of nuclear energy. However, uranium is dangerously chemically toxic and radioactive and, if diffused into the environment, can cause irreparable biological hazards. Uranyl ion (UO 2 2+ ) is the main form of uranium in the water environment and has high biocompatibility. Currently used for trace amounts of uranyl ions (UO 2 2+ ) detection methods are ray detection method, X-ray fluorescence method, atomic spectrometry and ICP-MS method. These methods require expensive precision instruments and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/00
CPCC12Q1/005
Inventor 何璇刘渝
Owner INST OF CHEM MATERIAL CHINA ACADEMY OF ENG PHYSICS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com