Biological sensing chip capable of circularly detecting trace uranyl ions and preparation method and application method of chip
A cycle detection and biosensing technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of low sensitivity and selectivity, and achieve low sensitivity and selectivity, good selectivity, The effect of high-sensitivity and rapid detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] 1) preparing the DNAzyme biosensing SERS chip of the present invention;
[0038] First prepare PS microsphere template, grow ZnO on the template, use magnetron sputtering to prepare ZnO-Ag composite material, use the prepared ZnO-Ag composite material substrate as SERS substrate, put the SERS substrate in a centrifuge tube, add Enzyme chain solution (concentration: 0.001M), so that the solution is immersed in the SERS substrate, the enzyme chain DNA:
[0039] RhBCCCCGCTCAAGTCTGGATTACACGTCCATCTCTGCAGTCGGGTAG TTAAACCGACCTTCAGACATAGTGAGTAAGCCTTT 5'-3'.
[0040] Place the centrifuge tube in a constant temperature mixer, 350 rpm, 25°C constant temperature, and react for 24 hours to make the DNA terminal sulfhydryl group covalently form silver-sulfur bonds with silver nanoparticles, and self-assemble on the surface of the SERS substrate to form a monomolecular layer . Then add 1 M saline solution to the solution five times every 2 hours, so that the final concentration of NaC...
Embodiment 2
[0044] Embodiment 2 The DNAzyme biosensing SERS chip of the present invention detects different metal ions at the same concentration:
[0045] Utilize the DNAzyme biosensing SERS chip described in embodiment one to soak respectively in the same concentration (10 -9 M) of different heavy metal ions (such as Ag + , Mg 2+ , Fe 3+ , Ca 2+ , Fe 2+ 、Co 2+ 、Ni 2+ 、Cd 2+ , Hg 2+ , Pb 2+ 、Th 4+ 、Ba 2+ , Mn 2+ ) solution for 10 minutes for Raman detection. Figure 4 It is a diagram of the test result of interfering ions in Example 2 of the present invention. Depend on Figure 4 It can be seen that the Raman spectrum of uranyl ion is significantly enhanced compared with other ion solutions, from Figure 4 It can be seen in the corresponding Raman peak 1366cm -1 The intensity of the chip can be used to quantitatively compare the differences between different ions, and the results show that the chip has good specificity and can accurately identify uranyl ions in the actual ...
Embodiment 3
[0046] Embodiment 3: Reconstruction and recycling test of the chip of the present invention
[0047] 1. If figure 1 As shown, the reconstruction of the biochip of the present invention is after a detection, the chip is washed with PBS to remove residual DNA and uranyl ions, the chip is taken out, and mixed with the substrate chain dissolved in the hybridization buffer at a constant temperature Mix and incubate at 37°C for 24 hours in the instrument, substrate strand concentration: 0.001M, substrate strand DNA:
[0048] AAAGGCTTTTAATCACTCACTTrAGGAAGAGATGGACGTGTAATCCAGACTTGAGCGGG 5'-3', rA (ribonucleotide adenosine) represents the base A in ribonucleotide;
[0049] The DNA double-stranded structure was formed by DNA complementary pairing, then washed several times with PBS buffer, dried with nitrogen, and reconstructed to obtain the DNAzyme biosensing SERS chip ( Figure 5 ). In the above process, the pH value can be selected as 6.88.
[0050] 2. The recycling experiment of ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


