Potato late blight resistance gene diagnosis primers and design method thereof

A technology for potato late blight and disease resistance genes, which is applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., and can solve problems such as the inability to guarantee the specificity of amplified products

Active Publication Date: 2019-09-13
HUAZHONG AGRICULTURAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Problems in the existing technology: At present, there is no ideal marker that can be used for molecular marker-assisted selection of the R8 gene
Using the sequence of the start codon and stop codon of the R8 gene to design PCR amplification primers can amplify a fragment of the expected size, but the specificity of the amplified product cannot be guaranteed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Potato late blight resistance gene diagnosis primers and design method thereof
  • Potato late blight resistance gene diagnosis primers and design method thereof
  • Potato late blight resistance gene diagnosis primers and design method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036]This embodiment provides a kind of potato late blight resistance gene R8 diagnostic primers, including:

[0037] Tub gene internal reference primers:

[0038] Upstream primer: Tub-F: TTGGACAGTCTGGTGCTGGGAAT

[0039] Downstream primer: Tub-R: CCAGGGAATCTCAAACAGCAAG

[0040] R8 gene-specific diagnostic primers:

[0041] Upstream primer R8-Fd: CTGGCGCTGGTTTTGCTATGC

[0042] Downstream primer R8-Rd: TCTCTTCGACTTCTTCTTACGAGGTCTA

Embodiment 2

[0044] This embodiment provides a method for designing primers for the diagnosis of potato late blight resistance genes, including:

[0045] (1) R8 gene sequencing of different late blight resistant potato materials

[0046] The disease-resistant R genes of Solanaceae plants have conserved NB-LRR and NB-ARC domains, and 48,549 120-mer biotin-labeled RNA probes (purchased from Agilent Technologies Inc) were designed according to the conserved domains. The potato genomic DNA was extracted by CTAB method, and the genomic fragments were broken up by ultrasonic waves. The fragment size was about 400-500bp, and then the biotin-labeled RNA probe was used to capture the disease-resistant gene and its analogue fragments of the disease-resistant gene in the potato genome. Fragment sequencing, and then compare these sequencing fragments to the R8 gene sequence with a high stringency (1%) mismatch rate. If a material sequencing fragment can completely cover the R8 gene sequence region, it...

Embodiment 3

[0065] This embodiment provides a kind of potato late blight resistance gene diagnostic kit, comprising:

[0066] (1) Primer

[0067] Internal reference Tub gene primers, R8 gene specific primers, as attached Figure 4 (Schedule 1).

[0068] (2) PCR reaction Mix includes:

[0069] Taq DNA polymerase, dNTPs, MgCl 2 1. Reaction buffer solution, the concentration is 2×, it is recommended to use 2×Taq PCR MasterMix (Cat. No. PC0902) from Beijing Aidelai Biotechnology Co., Ltd. Other companies' commercial Taq DNA polymerase and supporting PCR reaction buffer and its dNTPs can be amplified normally.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides potato late blight resistance gene R8 diagnosis primers and a design method thereof. The diagnosis primers comprise a Tub gene internal reference primer and an R8 gene specificdiagnosis primer. The primers designed by the invention can be used for accurately identifying whether potato materials contain R8 genes, can perform high-throughput tests on hundreds of samples within 2 days and can be used for large-scale and rapid molecular marker-assisted selection of the resistance gene R8 of potato late blight resistance breeding filial generation materials.

Description

technical field [0001] The invention belongs to the identification field of potato late blight resistance gene, in particular to a potato late blight resistance gene diagnostic primer and a design method thereof, and a kit for identifying potato late blight resistance gene R8 by using the primer. Background technique [0002] Potato is an important crop that is widely cultivated in the world for food, vegetables and feed. China's potato cultivation area and output both rank first in the world. During the production process, potatoes suffer from various diseases, among which the late blight caused by the oomycete Phytophthora infestans (Mont.) de Bary is the most serious disease, and the losses caused by late blight in normal years It can reach 20-30%, and in severe cases, it can reach more than 50%. In extreme years, it may even cause potato crop failure in some areas. Therefore, resistance to late blight is a very important breeding goal for potatoes in my country and the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6895C12Q1/6806C12N15/11
CPCC12Q1/6806C12Q1/6895C12Q2600/13
Inventor 田振东余小玲何欢罗鸣杜博文
Owner HUAZHONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap