Gene tandem super-expression vector for increasing nitrogen utilization efficiency and application thereof

An overexpression and gene technology, applied in the field of genetic engineering, can solve the problems of low nitrogen utilization rate and achieve the effect of improving plant nitrogen utilization rate and efficiency

Inactive Publication Date: 2019-09-20
INST OF SOIL SCI CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This high-yield and high-input intensive production model not only leads to a continuous decline in nitrogen fertilizer use efficiency, but also excessive nitrogen has a greater negative impact on the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene tandem super-expression vector for increasing nitrogen utilization efficiency and application thereof
  • Gene tandem super-expression vector for increasing nitrogen utilization efficiency and application thereof
  • Gene tandem super-expression vector for increasing nitrogen utilization efficiency and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Such as Figure 1-4 As shown, the construction method of the gene tandem overexpression vector for improving nitrogen utilization efficiency is as follows:

[0024] 1. Construction of pCambia2301-35S-nos-OsAMT1; 1 overexpression vector;

[0025] 1) OsAMT1;1 gene clone:

[0026] The total RNA of rice roots grown in hydroponic culture for 10 days was extracted and used as a template and reverse-transcribed with Oligo(dT)18 as a primer to obtain cDNA of the reverse-transcribed product. Using this cDNA as a template, the specific primer OsAMT1.1-KpnI-P 1 and OsAMT1.1-XbaI-P 2 Perform PCR amplification;

[0027] Upstream primer: OsAMT1.1-KpnI-P 1 (corresponding to the polynucleotide sequence SEQ ID NO.3 in the sequence listing) GTCGGTACCATGGCGACGTGCGCGGCGGACCTG

[0028] Downstream primer: OsAMT1.1-XbaI-P 2 (corresponding to the polynucleotide sequence SEQ ID NO.4 in the sequence listing)

[0029] GTC TCTAGATTACACTTGGTTGTTGCTGTTGG

[0030] Gene full-length PCR reacti...

Embodiment 2

[0071] 2.1 Preparation of transgenic Arabidopsis materials:

[0072] The single gene expression vector pCambia2301-35s-OsAMT1 constructed by Example 1; 1-nos infects wild-type Arabidopsis Col-0 (purchased from ATCC, USA) by screening (in the presence of 50 μg / mL kanamyces Screening on the 1 / 2MS plate of prime) resistant pure-line seedlings, and identification of overexpressed Arabidopsis pure-line material OsAMT1; 1OE#1 and OsAMT1; 1OE#6 (as shown in Figure 6 and Figure 7 shown).

[0073] The multigene overexpression vector pCambia2301-35s-OsAMT1 constructed by Example 1; 1+OsGS1; 2-nos infect wild-type Arabidopsis Col-0 (purchased from ATCC, USA) by screening (in 50 μg / mL kanamycin 1 / 2MS plate) resistant pure-line seedlings were identified and overexpressed Arabidopsis pure-line material OsAMT1; 1+OsGS1; 2OE#3, OsAMT1; 1+OsGS1; 2#6 and OsAMT1; 1+OsGS1; 2#7 (eg Image 6 with Figure 7 shown).

[0074] 2.2 Determination of N content

[0075] Experimental group: pCambia2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene tandem super-expression vector for increasing nitrogen utilization efficiency, wherein the genes serially linked to the vector are an ammonium transporter gene and an ammonium metabolic gene. The application firstly proposes that the ammonium transporter gene and the ammonium metabolic gene are simultaneously assembled into plants, and the efficiency of the absorption and utilization of the ammonium nitrogen by the plant is clearly increased, and the synergistic effect of the root absorption and the ammonium assimilation utilization pathway in the plant is considered, which breaks the inhibitory effect of ammonium accumulation in the body on absorption, and effectively improves the nitrogen utilization rate of plants.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a gene tandem overexpression carrier for improving nitrogen utilization efficiency and application thereof. Background technique [0002] Nitrogen is one of the three mineral nutrients necessary for plant growth and development. Nitrogen fertilization plays an extremely critical role in increasing crop yield. The inorganic nitrogen that can be used by plants in the soil is mainly ammonium nitrogen and nitrate nitrogen. In well-ventilated soil, nitrate nitrogen is the main form of nitrogen; while in flooded environment or acidic soil, ammonium nitrogen is the main form of nitrogen. The main form of nitrogen. Usually, the concentration of nitrate and ammonium ions in the soil solution varies within the range of 0.1 to 10 mM due to differences in soil type, texture, nitrogen fertilizer application amount, fertilizer type and fertilization method. [0003] In agricultur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00A01H6/20
CPCC12N15/8243
Inventor杨顺瑛苏彦华
OwnerINST OF SOIL SCI CHINESE ACAD OF SCI