Gene tandem super-expression vector for increasing nitrogen utilization efficiency and application thereof
An overexpression and gene technology, applied in the field of genetic engineering, can solve the problems of low nitrogen utilization rate and achieve the effect of improving plant nitrogen utilization rate and efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Such as Figure 1-4 As shown, the construction method of the gene tandem overexpression vector for improving nitrogen utilization efficiency is as follows:
[0024] 1. Construction of pCambia2301-35S-nos-OsAMT1; 1 overexpression vector;
[0025] 1) OsAMT1;1 gene clone:
[0026] The total RNA of rice roots grown in hydroponic culture for 10 days was extracted and used as a template and reverse-transcribed with Oligo(dT)18 as a primer to obtain cDNA of the reverse-transcribed product. Using this cDNA as a template, the specific primer OsAMT1.1-KpnI-P 1 and OsAMT1.1-XbaI-P 2 Perform PCR amplification;
[0027] Upstream primer: OsAMT1.1-KpnI-P 1 (corresponding to the polynucleotide sequence SEQ ID NO.3 in the sequence listing) GTCGGTACCATGGCGACGTGCGCGGCGGACCTG
[0028] Downstream primer: OsAMT1.1-XbaI-P 2 (corresponding to the polynucleotide sequence SEQ ID NO.4 in the sequence listing)
[0029] GTC TCTAGATTACACTTGGTTGTTGCTGTTGG
[0030] Gene full-length PCR reacti...
Embodiment 2
[0071] 2.1 Preparation of transgenic Arabidopsis materials:
[0072] The single gene expression vector pCambia2301-35s-OsAMT1 constructed by Example 1; 1-nos infects wild-type Arabidopsis Col-0 (purchased from ATCC, USA) by screening (in the presence of 50 μg / mL kanamyces Screening on the 1 / 2MS plate of prime) resistant pure-line seedlings, and identification of overexpressed Arabidopsis pure-line material OsAMT1; 1OE#1 and OsAMT1; 1OE#6 (as shown in Figure 6 and Figure 7 shown).
[0073] The multigene overexpression vector pCambia2301-35s-OsAMT1 constructed by Example 1; 1+OsGS1; 2-nos infect wild-type Arabidopsis Col-0 (purchased from ATCC, USA) by screening (in 50 μg / mL kanamycin 1 / 2MS plate) resistant pure-line seedlings were identified and overexpressed Arabidopsis pure-line material OsAMT1; 1+OsGS1; 2OE#3, OsAMT1; 1+OsGS1; 2#6 and OsAMT1; 1+OsGS1; 2#7 (eg Image 6 with Figure 7 shown).
[0074] 2.2 Determination of N content
[0075] Experimental group: pCambia2...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap