BsAKR (bacillus subtilis aldo-keto reductase) (YvgN) as well as mutants of BsAKR (YvgN) and application of mutants

A reductase and mutant technology, which is applied in various mutants of ketoreductase, secondary alcohol compounds in S or R configuration, various mutants of aldehyde and ketone reductase and their preparation fields, can solve application limitations, harsh conditions, Eliminate heavy metal residues and other problems, and achieve the effect of improving activity and enantioselectivity

Active Publication Date: 2019-09-27
SHENYANG PHARMA UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Researchers have developed a chemical synthesis method for the synthesis of optically pure chiral alcohols by using chiral metal ligands as catalysts, and some of them have been used in industrial production. applications are limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • BsAKR (bacillus subtilis aldo-keto reductase) (YvgN) as well as mutants of BsAKR (YvgN) and application of mutants
  • BsAKR (bacillus subtilis aldo-keto reductase) (YvgN) as well as mutants of BsAKR (YvgN) and application of mutants
  • BsAKR (bacillus subtilis aldo-keto reductase) (YvgN) as well as mutants of BsAKR (YvgN) and application of mutants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1 Extraction of Bacillus subtilis Genomic DNA

[0066] a) After culturing Bacillus subtilis with LB liquid overnight, centrifuge the fermentation liquid in a 1mL centrifuge tube at 3000r / min for 5min, discard the supernatant to collect the bacteria, and repeat several times to obtain a sufficient amount of cells; b) Extract reagents according to bacterial genome DNA Cassette instructions for extracting the Bacillus cereus genome.

Embodiment 2

[0067] Cloning of embodiment 2 wild-type BsAKR (YvgN) gene

[0068] With the Bacillus subtilis genomic DNA that embodiment 1 obtains as template, carry out PCR reaction, reaction system is as follows:

[0069]

[0070] Amplification program: 94°C: 10min, (94°C: 30s, 45°C: 30s, 72°C: 30s) 30 cycles, 72°C, 10min.

[0071] Primer 1: BsAKR(YvgN)-EcoR I-F: CCG GAATTC GATGCCAACAAGTTTAAAAA;

[0072] Primer 2: BsAKR(YvgN)-Xho I-R: CCG CTCGAG AAACAGAAGCTCATCAGG;

[0073] Restriction endonuclease cut sites are underlined;

[0074] The DNA fragments amplified by PCR were purified using a gel extraction kit. E.coli DH5α containing the pET28b MBP plasmid was cultured overnight in LB liquid medium at 37°C and 220r / min, and the plasmid was extracted using the reference TIANprep Mini PlasmidKit.

[0075] The target fragment and the plasmid pET28b MBP plasmid are limited to double enzyme digestion, and the enzyme digestion system is as follows:

[0076]

[0077] The digested pro...

Embodiment 3

[0078] Example 3 Preparation and transformation of E.coli Rosetta (DE3) competent cells

[0079] a) Take 0.4mL from the seed medium and inoculate it into 20mL LB liquid medium for 3h; b) 3000r / min, enrich 2mL of bacteria in 1.5mL EP tube twice for 5min, discard the supernatant; c) add 100 μl of ice-cold TSS solution, resuspend the cells, and ice-bath for 30 minutes; d) add 20 μL of linking solution, swirl and mix gently, and ice-bath for 30 minutes; e) heat shock at 42°C for 60 seconds, ice-bath for 2 minutes, and add 600 μL of LB liquid medium. Cultivate at 37°C and shake at 150r / min for 1h; f) Take 150μL and spread them on LB resistant plates.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the biotechnology field, in particular to multiple mutants of aldo keto reductase as well as an application and a preparation method of the mutants. The mutants are obtained through mutation of wild type BsAKR (YvgN). The invention also relates to a method for obtaining an S or R configuration secondary alcohol compounds by catalyzing reduction of alpha-keto ester compounds and 1-phenyl ethyl ketone compounds by use of the BsAKR (YvgN) and the mutants of the BsAKR (YvgN). Compared with wild types, the mutants have improved or reversed stereoselectivity, chiral alcohol of two configurations (R or S configuration) can be obtained by catalyzing the substrate, such as optically pure methyl (R)-o-chloromandelate, ethyl (S)-2-hydroxy-4-phenylbutyrate and ethyl (R)-2-hydroxy-4-phenylbutyrate, and the BsAKR (YvgN) has good application values in the field of preparation of chiral alcohol.

Description

technical field [0001] The present invention relates to the field of biotechnology, and relates to a variety of ketoreductase mutants and uses thereof. The mutants are derived from wild-type Bacillus subtilis aldo-keto reductase (BsAKR (YvgN)) It is obtained through mutation, and specifically relates to a variety of mutants of aldehyde and ketone reductase and a preparation method thereof. It also relates to the use of the aldehyde and ketone reductase BsAKR (YvgN) and its mutants to obtain optically active S or R configuration secondary compounds by catalyzing the reduction of α-ketoester compounds and 1-phenylethanone compounds. method of alcohol compounds. Background technique [0002] The chiral carbon atoms of chiral alcohols are connected with active hydroxyl functional groups, making chiral alcohols a key synthetic intermediate for fine chemical, pharmaceutical and agricultural applications. For example, the chiral alcohol (3R,5R)-6-cyano-3,5-dihydroxyhexanoate (eth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12N1/21C12P7/04C12R1/19
CPCC12N9/0006C12N15/70C12P7/04
Inventor游松秦斌张文鹤祝天慧张飞霆郭继阳张瑞李衡宇
OwnerSHENYANG PHARMA UNIVERSITY