BsAKR (bacillus subtilis aldo-keto reductase) (YvgN) as well as mutants of BsAKR (YvgN) and application of mutants
A reductase and mutant technology, which is applied in various mutants of ketoreductase, secondary alcohol compounds in S or R configuration, various mutants of aldehyde and ketone reductase and their preparation fields, can solve application limitations, harsh conditions, Eliminate heavy metal residues and other problems, and achieve the effect of improving activity and enantioselectivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Example 1 Extraction of Bacillus subtilis Genomic DNA
[0066] a) After culturing Bacillus subtilis with LB liquid overnight, centrifuge the fermentation liquid in a 1mL centrifuge tube at 3000r / min for 5min, discard the supernatant to collect the bacteria, and repeat several times to obtain a sufficient amount of cells; b) Extract reagents according to bacterial genome DNA Cassette instructions for extracting the Bacillus cereus genome.
Embodiment 2
[0067] Cloning of embodiment 2 wild-type BsAKR (YvgN) gene
[0068] With the Bacillus subtilis genomic DNA that embodiment 1 obtains as template, carry out PCR reaction, reaction system is as follows:
[0069]
[0070] Amplification program: 94°C: 10min, (94°C: 30s, 45°C: 30s, 72°C: 30s) 30 cycles, 72°C, 10min.
[0071] Primer 1: BsAKR(YvgN)-EcoR I-F: CCG GAATTC GATGCCAACAAGTTTAAAAA;
[0072] Primer 2: BsAKR(YvgN)-Xho I-R: CCG CTCGAG AAACAGAAGCTCATCAGG;
[0073] Restriction endonuclease cut sites are underlined;
[0074] The DNA fragments amplified by PCR were purified using a gel extraction kit. E.coli DH5α containing the pET28b MBP plasmid was cultured overnight in LB liquid medium at 37°C and 220r / min, and the plasmid was extracted using the reference TIANprep Mini PlasmidKit.
[0075] The target fragment and the plasmid pET28b MBP plasmid are limited to double enzyme digestion, and the enzyme digestion system is as follows:
[0076]
[0077] The digested pro...
Embodiment 3
[0078] Example 3 Preparation and transformation of E.coli Rosetta (DE3) competent cells
[0079] a) Take 0.4mL from the seed medium and inoculate it into 20mL LB liquid medium for 3h; b) 3000r / min, enrich 2mL of bacteria in 1.5mL EP tube twice for 5min, discard the supernatant; c) add 100 μl of ice-cold TSS solution, resuspend the cells, and ice-bath for 30 minutes; d) add 20 μL of linking solution, swirl and mix gently, and ice-bath for 30 minutes; e) heat shock at 42°C for 60 seconds, ice-bath for 2 minutes, and add 600 μL of LB liquid medium. Cultivate at 37°C and shake at 150r / min for 1h; f) Take 150μL and spread them on LB resistant plates.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More