Aldo-keto reductase BcAKR, mutants thereof, and application of aldo-keto reductase BcAKR and mutants
A reductase and mutant technology, which is applied in the preparation of aldo-keto reductase BcAKR and its mutants, and the field of aldo-keto reductase BcAKR and its mutants, can solve the problems of few successful examples, and achieve improved activity and enantioselectivity. sexual effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] The extraction of embodiment 1 Bacillus cereus genomic DNA
[0053] After culturing Bacillus cereus with LB liquid overnight, centrifuge the fermentation broth in a 1mL centrifuge tube at 3000r / min for 5min, discard the supernatant to collect the cells, and repeat several times to obtain a sufficient amount of cells; b) According to the bacterial genome DNA extraction kit Instructions for the extraction of the Bacillus cereus genome.
Embodiment 2
[0054] Cloning of embodiment 2 wild-type BcAKR gene
[0055] Carry out PCR reaction with the Bacillus cereus genomic DNA obtained in Example 1 as a template, and the reaction system is as follows:
[0056]
[0057] Amplification program: 94°C: 10min, (94°C: 30s, 45°C: 30s, 72°C: 30s) 30 cycles, 72°C, 10min.
[0058] Primer 1: BcAKR-EcoR I-F: CCG GAATTC GATGAAAAAACTTACAAAGT;
[0059] Primer 2: BcAKR-Xho I-R: CCG CTCGAG GAAATCGAAGTTATCAGG;
[0060] Restriction endonuclease cut sites are underlined;
[0061] The DNA fragments amplified by PCR were purified using a gel extraction kit. E.coli DH5α containing the pET28b MBP plasmid was cultured overnight in LB liquid medium at 37°C and 220r / min, and the plasmid was extracted using the reference TIANprep Mini PlasmidKit.
[0062] The target fragment and the plasmid pET28b MBP plasmid are limited to double enzyme digestion, and the enzyme digestion system is as follows:
[0063]
[0064] The digested products were recov...
Embodiment 3E
[0065] Preparation and transformation of embodiment 3E.coli Rosetta (DE3) competent cells
[0066] a) Take 0.4mL from the seed medium and inoculate it into 20mL LB liquid medium for 3h; b) 3000r / min, enrich 2mL of bacteria in 1.5mL EP tube twice for 5min, discard the supernatant; c) add 100 μl of ice-cold TSS solution, resuspend the cells, and ice-bath for 30 minutes; d) add 20 μL of linking solution, swirl and mix gently, and ice-bath for 30 minutes; e) heat shock at 42°C for 60 seconds, ice-bath for 2 minutes, and add 600 μL of LB liquid medium. Cultivate at 37°C and shake at 150r / min for 1h; f) Take 150μL and spread them on LB resistant plates.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More