Application of MYB6 protein and coding gene thereof in regulating verticillium wilt resistance of plants
A MYB6, transgenic plant technology, applied in applications, plant peptides, plant products, etc., can solve problems such as no efficient control methods and failure to fundamentally study clearly.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0100] Example 1, transcription factor MYB6 interacts with PUB25 and PUB26 in vivo
[0101] 1. Yeast two-hybrid library screening for interacting proteins of PUB25 and PUB26
[0102] Yeast library screening was carried out to find the substrates of PUB25 and PUB26 in Arabidopsis. The specific steps are as follows: First, the U-box domain in the U-box type E3 generally plays a mediating role in the ubiquitination process, and the ARM domain plays a role in mediating the interaction between proteins. In order to prevent the full-length PUB During the interaction between the protein and the substrate, the substrate is degraded and affects the screening. PUB26 is truncated, and only the ARM domain is retained. The bait vector BD-PUB26-ARM is constructed and transformed into a gold yeast strain, and the yeast cDNA library is screened. All the transformation products were smeared on 4D medium. After the colony PCR, 200 products were directly sequenced, and the sequences were compar...
Embodiment 2
[0125] Example 2, the application of MYB6 in regulating plant resistance to Verticillium dahliae
[0126] 1. Obtaining and RT-PCR identification of myb6 mutant
[0127] 1. Obtaining the myb6 mutant
[0128] The myb6 T-DNA insertion mutants were obtained from the ABRC Seed Center, which were designated as myb6-1 mutant and myb6-2 mutant, and the product numbers were SALK_074789C and CS403018, respectively.
[0129] 2. RT-PCR identification of mutants
[0130] The expression of MYB6 gene in wild-type Arabidopsis (Col-0) and myb6 mutant was detected by RT-PCR. The ACTIN2 gene was used as an internal reference gene. The primer sequences are as follows:
[0131] MYB6-RT-F: TGGTCATTGATAGCTGGAAGATTACC;
[0132] MYB6-RT-R: AGAATACTCAACGGCATCGTTTTGAATA.
[0133] The results showed that the relative expression of MYB6 gene in myb6-1 mutant and myb6-2 mutant was lower than that of wild type Arabidopsis ( image 3 ).
[0134] 2. Acquisition of MYB6-transferred Arabidopsis lines an...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



