Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of MYB6 protein and coding gene thereof in regulating verticillium wilt resistance of plants

A MYB6, transgenic plant technology, applied in applications, plant peptides, plant products, etc., can solve problems such as no efficient control methods and failure to fundamentally study clearly.

Active Publication Date: 2019-10-11
CHINA AGRI UNIV
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although many scientists are committed to the research of this disease, they have not yet been able to fundamentally study its pathogenesis, and there is currently no efficient and economical control method. The pathogenesis of Verticillium dahliae and the cultivation of disease-resistant varieties have brought hope. Understanding the pathogenesis of Verticillium dahliae from the perspective of molecular biology, and then enhancing the resistance of plants to Verticillium dahliae through genetic engineering technology has become the hope to solve this problem.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of MYB6 protein and coding gene thereof in regulating verticillium wilt resistance of plants
  • Application of MYB6 protein and coding gene thereof in regulating verticillium wilt resistance of plants
  • Application of MYB6 protein and coding gene thereof in regulating verticillium wilt resistance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0100] Example 1, transcription factor MYB6 interacts with PUB25 and PUB26 in vivo

[0101] 1. Yeast two-hybrid library screening for interacting proteins of PUB25 and PUB26

[0102] Yeast library screening was carried out to find the substrates of PUB25 and PUB26 in Arabidopsis. The specific steps are as follows: First, the U-box domain in the U-box type E3 generally plays a mediating role in the ubiquitination process, and the ARM domain plays a role in mediating the interaction between proteins. In order to prevent the full-length PUB During the interaction between the protein and the substrate, the substrate is degraded and affects the screening. PUB26 is truncated, and only the ARM domain is retained. The bait vector BD-PUB26-ARM is constructed and transformed into a gold yeast strain, and the yeast cDNA library is screened. All the transformation products were smeared on 4D medium. After the colony PCR, 200 products were directly sequenced, and the sequences were compar...

Embodiment 2

[0125] Example 2, the application of MYB6 in regulating plant resistance to Verticillium dahliae

[0126] 1. Obtaining and RT-PCR identification of myb6 mutant

[0127] 1. Obtaining the myb6 mutant

[0128] The myb6 T-DNA insertion mutants were obtained from the ABRC Seed Center, which were designated as myb6-1 mutant and myb6-2 mutant, and the product numbers were SALK_074789C and CS403018, respectively.

[0129] 2. RT-PCR identification of mutants

[0130] The expression of MYB6 gene in wild-type Arabidopsis (Col-0) and myb6 mutant was detected by RT-PCR. The ACTIN2 gene was used as an internal reference gene. The primer sequences are as follows:

[0131] MYB6-RT-F: TGGTCATTGATAGCTGGAAGATTACC;

[0132] MYB6-RT-R: AGAATACTCAACGGCATCGTTTTGAATA.

[0133] The results showed that the relative expression of MYB6 gene in myb6-1 mutant and myb6-2 mutant was lower than that of wild type Arabidopsis ( image 3 ).

[0134] 2. Acquisition of MYB6-transferred Arabidopsis lines an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of MYB6 protein and a coding gene thereof in regulating verticillium wilt resistance of plants. Through a co-immunoprecipitation and firefly luciferase complementary test, it is proved that MYB6 and full-length PUB25 and PUB26 react in vivo, through a phenotypic experiment, it is proved that an myb6 mutant after MYB6 mutation is more sensitive to verticiliumdahliae, and the verticillium wilt resistance of the transgenic plants overexpressing the MYB6 is improved, which proves that the MYB6 participates in the regulation of the immune response of the plants to the verticiliumdahliae, and has great value in improving disease resistance of the plants, especially verticillium wilt resistance, and plant breeding.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to the application of MYB6 gene and its encoded protein in regulating plant resistance to Verticillium wilt. Background technique [0002] Verticillium wilt is a disease that is extremely harmful to plants. After Verticillium dahliae infects plants, it causes symptoms such as wilting and yellowing of leaves, and even causes plant death. Verticillium wilt is a soil-borne systemic infection disease. According to current statistics, more than 400 dicotyledonous plants will be infected by it, including some common crops, such as cotton, eggplant and tomato. Verticillium wilt will cause crop yield reduction or even extinction. production, resulting in major economic losses. The harm of Verticillium wilt is more prominent in cotton. In my country, the economic loss caused by Verticillium wilt reaches billions of yuan every year, and the incidence trend increases year by year. Ther...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N5/10A01H5/00A01H6/20A01H6/60A01H6/82
CPCC07K14/415C12N15/8282
Inventor 齐俊生巩志忠洪旭辉马爱芳张定朋王广兴
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More