Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A molecular marker locus linked to the content of tea plant epicatechin and its application

An epicatechin and molecular marker technology, applied in the field of molecular genetics and breeding, can solve problems such as failure to find and affect the content of epicatechin, and achieve the effect of great research value

Active Publication Date: 2020-09-08
TEA RES INST GUANGDONG ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The discovery of molecular markers closely linked to the excellent traits of tea trees is the basis for molecular marker-assisted selection breeding of tea trees. However, due to the limitations of traditional QTL mapping research progress, it has not been possible to find SNP molecular markers that affect the content of epicatechin.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker locus linked to the content of tea plant epicatechin and its application
  • A molecular marker locus linked to the content of tea plant epicatechin and its application
  • A molecular marker locus linked to the content of tea plant epicatechin and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] 1. Experimental samples

[0053] Collected 191 tea tree materials located in the Guangdong Tea Tree Germplasm Resource Bank (Guangdong, Yingde, 113.3OE, 24.3ON), including 124 in Guangdong, 20 in Fujian, 15 in Guangxi, 9 in Zhejiang, 6 in Hunan, and 6 in Yunnan. 1 copy in Jiangxi, 1 copy in Guizhou, and 1 copy in Taiwan. In addition, 8 descendants of Kenyan tea species and 1 descendant of Georgian species, the selected materials are widely representative.

[0054] The selected resources are randomly distributed in the resource pool. Single planting in double rows, each row 4m, row spacing 1.5m, plant spacing 35cm. The resource bank conducts routine water and fertilizer management. At the end of 2016, the resources were pruned and basal fertilizer was applied in deep pits, 4 tons of organic fertilizer, 0.75 tons of peanut bran and 10 catties of compound fertilizer per mu. After spring tea and summer tea in 2017, pruning and topdressing outside the roots, 30 catties o...

Embodiment 2

[0079] Example 2 Verification of molecular markers in another population

[0080] 1. Experimental method

[0081] The SNP site located at Scaffold2233:468642 was verified in another population containing 98 germplasm.

[0082] 1. Detect the epicatechin content of each sample. The specific detection method is the same as in Example 1.

[0083] 2. Use the SnaPShot technology platform to detect the genotype of the SNP site of Scaffold2233:468642 in each sample.

[0084] This method designs primers of different lengths for different mutation sites. After the SNaPshot reaction, the products are separated by electrophoresis, detected by five-color fluorescence, and analyzed by Gene mapper. Multiple SNP sites can be detected in one sequencing reaction. Using SNaPshot for fixed-point sequence analysis, its basic principle follows the dideoxy termination method in direct DNA sequencing, the difference is that there are only different fluorescently labeled ddNTPs in the PCR reaction....

Embodiment 3

[0122] Example 3 A kit for evaluating the content of tea tree epicatechin

[0123] 1. Composition

[0124] Its nucleotide sequence is shown in the primers shown in SEQ ID NO: 2-3, 2×Taq PCR Master Mix, ddH 2 O.

[0125] Wherein, primer F: CAATGCATAATGCTCTACCC (SEQ ID NO: 2);

[0126] Primer R: TGTGTGCGAATCGTTGAAGC (SEQ ID NO: 3).

[0127] 2. How to use

[0128] (1) Extract the total DNA of tea tree shoots by CTAB method, and ensure that the A260 / A280 of each DNA sample is between 1.8 and 2.0, and the concentration is greater than 100 μg / μl;

[0129] (2) PCR amplification

[0130] The PCR system (10μl) is as follows:

[0131] 2×Taq PCR Master Mix 5μl Primer 0.5μl each DNA template 1μl wxya 2 o

3μl

[0132] The PCR amplification procedure is as follows:

[0133]

[0134] (3) Product purification

[0135] The PCR amplification product was subjected to gel electrophoresis, and then recovered and purified using a commercially avai...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker site linked with epicatechin (epicatechin, EC) content of camellia sinensis trees and an application of the molecular marker site. For the first time, the inventor of the invention finds that an SNP molecular marker site pertinent to the epicatechin content of the camellia sinensis trees on a camellia sinensis tree genome Scaffold2233: 468642, and the genotype is significantly correlated with the epicatechin content. The relevance and significance verification result indicates that compared with GG genotype samples and GA genotype samples, the epicatechin content in tea soup dry substances corresponding to AA genotype samples has significant differences. Judgment is performed through statistics, when the genotype is double mutation AA, the epicatechin content in dry substances in the camellia sinensis trees is higher than that of the normal average level obtained from wild type GG or single mutation genotype GA by large probability. The detection method for detecting the site is further established, can be used for evaluating the epicatechin content of the camellia sinensis trees to be further used for screening and molecular breeding of high-EC (epicatechin) camellia sinensis tree resources, and has great research value.

Description

technical field [0001] The invention relates to the technical field of molecular genetic breeding, and more specifically relates to a molecular marker site linked with the content of epicatechin (epicatechin) in tea plants and an application thereof. Background technique [0002] Tea (Camellia sinensis (L.) O.Kuntze) belongs to the tea group of the genus Camellia in the family Theaceae, originated in the southwestern region of China, and has a cultivation history of more than 5,000 years ago. Tea, coffee, and cocoa are known as the world's three major non-alcoholic beverages, which have important economic value and have an important impact on society and culture. [0003] The characteristic secondary metabolites catechins in tea shoots are the main factors affecting the taste of tea. Catechin compounds are derivatives of 2-phenylbenzopyran, belonging to flavan-3-ols in flavonoid compounds, accounting for 12% to 24% of the dry weight of tea leaves. According to the number o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156C12Q2600/172
Inventor 方开星吴华玲姜晓辉秦丹丹李红建王秋霜潘晨东李波黄华林
Owner TEA RES INST GUANGDONG ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com