Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of protein in preventing and treating spodoptera frugiperda and/or spodoptera litura

A technology of Spodoptera frugiperda and Spodoptera litura, which is applied to the application field of protein in the control of Spodoptera frugiperda and/or Spodoptera litura, to achieve good insecticidal activity and solve the effects of drug resistance and resistance

Active Publication Date: 2019-12-31
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF6 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And along with Bacillus thuringiensis (abbreviation Bt) delta-endotoxin (insecticidal crystal protein, semi-encapsulated crystal protein) is widely used in microbial engineering bacteria and transgenic insect-resistant plants, causing some insects to kill insects on this type of Bt Protein produces drug resistance and resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of protein in preventing and treating spodoptera frugiperda and/or spodoptera litura

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0011] Expression of Vip protein

[0012] Design primer F1 / R1 (SEQ ID No.2 / SEQ IDNo.3; ATGAACAAGAATAATACTAAATTAAGC; CTACTTAATAGAGACATCGTAAAAATG TAC) based on the nucleotide sequence shown in SEQ ID No.1, both the nucleotide sequence and primers of SEQ ID No.1 Synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. Wherein, the nucleotide shown in SEQ ID No.1 encodes the protein shown in SEQ ID No.4 (ie Vip protein).

[0013] Using F1 / R1 as a template and the synthesized nucleotide shown in SEQ ID No.1 as a template, PCR amplification was performed, and then the amplified product was connected to the pET28a vector to obtain the pET-VIP recombinant plasmid, Then the positive recombinant plasmid was transformed into Escherichia coli BL21(DE3), and the positive transformant BL21(DE3) / pET-VIP was screened out.

[0014] Pick the fresh bacterium colony of BL21 (DE3) / pET-VIP and inoculate in the LB liquid culture medium of 5ml and activate 8 hours, then inoculate in the fermenter ...

Embodiment 2

[0017] Expression of mutant protein S543N

[0018] Primers F2 / R2 (SEQ ID No.5 / SEQ ID No.6; ATTGTAGAGAACGGGAACATAGAAGAGG; TTCCCGTTCTCTACAATATTGCTAATAAA) were designed to perform S543N mutation on SEQ ID No.4, and the amino acid sequence of the mutant protein S543N is shown in SEQ ID No.7. The target nucleotide was also connected to the pET28a vector to obtain the pET-S543N recombinant plasmid, and then the positive recombinant plasmid was transferred into Escherichia coli BL21(DE3), and the positive transformant BL21(DE3) / pET-S543N was screened out.

[0019] Induce the expression of S543N protein in the same manner as in the examples, and the results show that the expression of S543N protein in the supernatant (soluble fraction) is more than that in the precipitate (insoluble fraction). Therefore, killing with the soluble fraction Insect activity analysis.

[0020] Likewise, the concentration of S543N protein was quantified by BSA prior to activity assays.

Embodiment 3

[0022] Determination of insecticidal activity against Spodoptera frugiperda

[0023] 20mmol / L Tris-HCl (pH 8.0) was used as the blank control; the concentration of Vip protein was set to 2.50μg / mL, 5.00μg / mL, 10.00μg / mL, 20.00μg / mL, 40.00μg / mL, 80.00μg / mL, 160.00μg / mL, 320.00μg / mL; set the concentration of S543N to 2.50μg / mL, 5.00μg / mL, 10.00μg / mL, 20.00μg / mL, 40.00μg / mL, 80.00μg / mL , 160.00 μg / mL, 320.00 μg / mL.

[0024] Weigh 5g of artificial feed (recipe in Table 1) into a sterilized petri dish, add 1mL of protein samples to be tested or blank control at various concentrations, mix well, and evenly distribute in sterilized 24-well cell culture plates , placed at room temperature until the excess water in the feed evaporates; use a brush to draw healthy, unfeeding newly hatched larvae of Spodoptera frugiperda (within 12 hours after hatching) into the wells containing the above feed, one head per hole Cover the worms with moist toilet paper, cover them with a plastic cover,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides an application of a protein in preventing and treating spodoptera frugiperda and / or spodoptera litura. The amino acid sequence of the protein is shown in SEQ ID No.4.

Description

technical field [0001] The invention provides the application of a protein in preventing and controlling Spodoptera frugiperda and / or Spodoptera litura. Background technique [0002] In recent years, the gnawing of lepidopteran pests has caused a large amount of crop yield reduction. And along with Bacillus thuringiensis (abbreviation Bt) delta-endotoxin (insecticidal crystal protein, semi-encapsulated crystal protein) is widely used in microbial engineering bacteria and transgenic insect-resistant plants, causing some insects to kill insects on this type of Bt Protein produces drug resistance and resistance. Contents of the invention [0003] One of the present invention provides the application of a protein in controlling Spodoptera frugiperda and / or Spodoptera litura, wherein the amino acid sequence of the protein shown is shown in SEQ ID No.4. [0004] The second invention provides the application of the composition containing the protein in the application according...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01N63/02A01G13/00A01P7/04
CPCA01G13/00
Inventor 张杰宋福平束长龙耿丽丽彭琦梁影屏
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com