Application of recombinant mesenchymal stem cells in preparing drugs for treating myocardial infarction

A technology of stem cells and recombinant plasmids, applied in bone/connective tissue cells, cells modified by introducing foreign genetic material, applications, etc., can solve problems such as application, low effect and scar tissue formation that are not involved in the treatment of cardiac infarction

Inactive Publication Date: 2020-01-07
SUZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The MSCs transplantation currently used in the treatment of myocardial infarction is a promising therapeutic approach, but there are still the following defects: 1) The early stage after acute myocardial infarction is mainly the necrosis of myocardial cells and the infiltration of inflammatory cells, scar tissue after 2 weeks Therefore, the best time for cell transplantation after myocardial infarction is within 14 days after myocardial infarction
Under normal conditions, MSCs are in a silent state, that is, their immune regulation function is in a weak state, resulting in a lower than expected effect of MSCs in treating immune-related diseases such as myocardial infarction
CN201780049088 discloses a composition for treating cancer, and CN201811589083 discloses a recombinant mesenchymal stem cell, which involves interleukin-modified MSCs, but does not involve the application in the treatment of myocardial infarction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of recombinant mesenchymal stem cells in preparing drugs for treating myocardial infarction
  • Application of recombinant mesenchymal stem cells in preparing drugs for treating myocardial infarction
  • Application of recombinant mesenchymal stem cells in preparing drugs for treating myocardial infarction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1. Isolation of rat mesenchymal stem cells:

[0042] 1) Under sterile conditions, separate the femur and tibia of the rat, and flush the bone marrow in the marrow cavity with a 1 mL syringe.

[0043] 2) The washed bone marrow was filtered through a 70 μm filter, and centrifuged at 1350 rpm for 15 minutes.

[0044] 3) Add erythrocyte lysate to resuspend and lyse for 5 minutes to lyse the erythrocytes in the bone marrow.

[0045] 4) Wash 1-2 times with PBS, then resuspend with freshly prepared DMEM / F12+10% FBS and inoculate in culture dish.

[0046] 5) After 72 hours, the non-adherent cells were sucked off, and the medium was changed every 2-3 days thereafter, and the cell density in the culture dish reached 80% to be subcultured. At this time, the cells were marked as P0 generation.

Embodiment 2

[0047] Example 2. Identification of rat mesenchymal stem cells:

[0048] 1) Take the P3-P5 generation cells in good growth state, digest the cells with 0.25% trypsin+EDTA, collect the cells and count them.

[0049] 2) Put 2×10 5 The cells were divided into a portion, and each portion was added with CD105-PE (12-1051, eBioscience), CD73-PE (551123, BD), CD90-PE (551401, BD), CD29-FITC (555005, BD), CD45- PE (6828, BD) and CD11b / c-FITC (b141556, Biolegend) antibodies.

[0050] 3) After mixing, incubate at 4°C in the dark for 20 minutes, wash with PBS twice, and then detect with a Guavaeasycyte flow cytometer. Test results such as figure 1 , the abscissa indicates the fluorescence intensity, and the ordinate indicates the number of cells.

Embodiment 3

[0051] Example 3. Design of IL-33 high expression plasmid for editing mesenchymal stem cells:

[0052] 1) Find the sequence of rat IL-33 on the NCBI website, and find that the gene has only one transcript, and the CDS region is continuous in the mRNA. The nucleotide sequence of IL-33 CDS is shown in SEQ ID No.3.

[0053] 2) It is predicted on the primer5 software that there are no restriction endonucleases BamHI and XbaI in the CDS region, so the primers in this region are designed to add BamHI and XbaI endonuclease sequences at both ends.

[0054] Primer sequence:

[0055] Front primer sequence: 5'TTAAGGATCCGCCACCATGAGACCTAGAATGAAGTATTCGAAC3' (SEQ ID No.1);

[0056] Rear primer sequence: 5'TTTTTCTAGATTACATCTTAGAGAGCTTAAACATGATAT3' (SEQ ID No. 2).

[0057] Using the front and back primer sequences, the complete sequence of IL-33 was obtained by PCR amplification. The PCR amplification conditions were as follows: 95°C, 5min; (95°C, 30s-45s; 60°C, 45s; 72°C, 45s-60s) -35-40 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of IL-33 in preparing mesenchymal stem cell immunoregulatory preparations. A recombinant allosome MSCs for regulating an immune reaction is built, IL-33 is used formodifying MSCs, the survival rate of the MSCs in a low-oxygen condition is improved, and the immunosuppressive function of the MSCs is improved by improving the influence of the allosome MSCs on macrophage polarization. The invention further discloses application of recombinant mesenchymal stem cells in preparing drugs for treating myocardial infarction. The drugs can treat the myocardial infarction through allosome cell transplantation.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to the application of recombinant mesenchymal stem cells in the preparation of drugs for treating myocardial infarction. Background technique [0002] Myocardial infarction is a cardiovascular disease that seriously endangers human health due to prolonged ischemia leading to myocardial cell death and fibrosis. With the development of social economy and the change of national lifestyle, the incidence of cardiovascular disease in my country is on the rise, and the mortality rate of acute myocardial infarction (AMI) is also increasing continuously. Moreover, it is difficult to cure it by existing methods. The most thorough method is heart transplantation, but heart transplantation is limited by the source of donors. Acute myocardial infarction will cause a severe innate immune response of heart cells, thereby mobilizing a large number of neutrophils, monocytes and macrophages to migrate to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N15/867A61K35/28A61P9/10
CPCA61K35/28A61P9/10C07K14/54C12N5/0662C12N2510/00
Inventor陈月秋沈振亚余云生
OwnerSUZHOU UNIV