Ultra-low frequency mutant nucleic acid fragment detection method, library construction method, primer design method and reagent

A technology for designing nucleic acid fragments and primers, which is applied in biochemical equipment and methods, and the determination/inspection of microorganisms, and can solve problems such as affecting the detection limit, loss of cfDNA templates, and loss of templates

Pending Publication Date: 2020-01-07
HUNAN YEARTH BIOTECHNOLOGICAL CO LTD
View PDF9 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The traditional amplicon enrichment technology is based on double-sided enrichment, which has the problem of cfDNA template loss, and trace amounts of ctDNA slip away
The unilateral enrichment technology can effectively solve the above problems. At present, there are two main unilateral enrichment techniques, one is unilateral enrichment-chain forming (back-to-back primer) mode; the other is unilateral enrichment-nesting PCR primer (nested PCR primer) mode; while the single-test enrichment-strand looping mode has no single-molecule labeling technology for noise reduction, and the single-test enrichment-nested PCR primer mode uses double primers to cause the 3' end of the primer to be detected The loci must be kept at a distance, and there will also be a small amount of template loss, so both seriously affect the detection limit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ultra-low frequency mutant nucleic acid fragment detection method, library construction method, primer design method and reagent
  • Ultra-low frequency mutant nucleic acid fragment detection method, library construction method, primer design method and reagent
  • Ultra-low frequency mutant nucleic acid fragment detection method, library construction method, primer design method and reagent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0112] Example 1 Micro Fragmentation DNA EGFR Gene Mutation Detection

[0113] 1.1 Joint design

[0114] Top-Adaptors:

[0115] 5'-P-ACGTCACGCAGGGGAGAGCCAGGGATGACTAGG-3', see SEQ ID NO.1.

[0116] P indicates phosphorylation modification.

[0117] Bottom-Adapter:

[0118] 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNCCCTGCGTGACGT*Y-3', see SEQ ID NO. 2. * stands for thio modification, Y stands for degenerate base A or T, N stands for random base A or T or G or C, which is used to distinguish and correct errors introduced by PCR and sequencing.

[0119] The above sequences need to be annealed into double strands.

[0120] EGFR gene: (EXON18, EXON19, EXON20, EXON21 below are the 4 exons upstream intron sequence, exon sequence, and downstream intron sequence of the 4 exons of EGFR gene)

[0121] EXON18

[0122] CAAGTGCCGTGTCCTGGCACCCAAGCCCATGCCGTGGCTGCTGGTCCCCCCTGCTGGGCCATGTCTGGCACTGCTTTCCAGCATGGTGAGGGCTGAGGTGACCCTGTCCTCTGTGTTCTTGTCCCCCCAGCTTGTGGAGCCTCTTACACCCAGTGGAGAAGCTC...

Embodiment 2B

[0235] Example 2 BRAF Gene Targeted Sequencing

[0236] 2.1 Joint design

[0237] Top-Adaptors:

[0238] 5'P-ACGTCACGCAGGGNNNNNNNNAGATGTGTATAAGAGACAG-3', see SEQ ID NO.21,

[0239] P indicates phosphorylation modification.

[0240] Bottom-Adapter:

[0241] 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNCCCTGCGTGACGTT-3', see SEQ ID NO. 22. The above sequences need to be annealed into double strands, and N represents a random base A or T or G or C, which is used to distinguish and correct errors introduced by PCR and sequencing.

[0242] The sequence of BRAF exon 11 is as follows:

[0243] AAAACACTTGGTAGACGGGACTCGAGTGATGATTGGGAGATTCCTGATGGGCAGATTACAGTGGGACAAAGAATTG[ G] ATCTGGATCATTT[ GGA] ACAGTCT[ A] CAAGGGAAAGTGGCATG, see SEQ ID NO. 23,

[0244] The sequences of BRAF exon 11 and its upstream and downstream introns are as follows:

[0245] CCTGTATCCCTCTCAGGCATAAGGTAATGTACTTAGGGTGAAACATAAGGTTTTCTTTTTCTGTTTGGCTTGACTTGACTTTTTACTGTTTTTATCAAGAAAACACTTGGTAGACGGGACTCGAGTGATGA...

Embodiment 3

[0345] Example 3 Ultra-low input cf-DNA gene detection one-step library construction

[0346] 3.1 Adapter primer design

[0347] 3.1.1 Joint design

[0348] Top-Adaptors:

[0349] 5'-P-ACGTCACGCAGGGNNNNNNNNAGATGTGTATAAGAGACAG-3', see SEQ ID NO.33,

[0350] P stands for phosphorylation modification.

[0351] Bottom-Adapter:

[0352] 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNCCCTGCGTGACGT*Y-3', see SEQID NO.34, *Y represents the degenerate base A or T modified by sulfo, N represents the random base A or T or G or C, used to distinguish correction PCR and Errors introduced by sequencing.

[0353] The above sequences need to be annealed into double strands.

[0354] Designed for the G12R site of exon 2 of the KRAS gene

[0355] The KRAS exon 2 sequence is as follows:

[0356] ATGACTGAATATAAACTTGTGGTAGTTGGAGCT[ G G]T[GG]CGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAG, see SEQ ID NO.35,

[0357] KRAS exon 2 and its upstream and downstream intro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an ultra-low frequency mutant nucleic acid fragment detection method, a mutant nucleic acid fragment library construction method, a primer design method and a reagent. Firstly,the fragmented nucleic acid of the sample to be tested is subjected to terminal repair, end-filling and adding A; connecting molecular tag joints; using the combination of molecular tag primers and single molecule specific primers to carry out amplicon targeted enrichment on the connection jointer product; finally, performing PCR amplification and enrichment. The single molecule specific primer designed by the invention obviously improves the number of available effective templates, and the carried adjustment sequence can obviously reduce the probability of forming primer dimers among specific primers, and the utilization rate of templates can be also obviously improved. The ultra-low frequency mutation nucleic acid fragment detection method of the invention uses one-sided single primer amplicon enrichment method and molecular label technology, improves the utilization rate of effective templates, reduces noise sources, reduces false positives, improves detection sensitivity and specificity, and is especially suitable for detection of trace ultra-low frequency mutation samples. At the same time, the invention can also carry out high-efficiency library construction.

Description

technical field [0001] The invention belongs to the technical field of molecular biology detection, and in particular relates to an ultra-low frequency mutation nucleic acid fragment detection method, a mutation nucleic acid fragment library construction method, a primer design method and reagents. Background technique [0002] The detection of somatic mutations by means of Next Generation Sequencing (Next Generation Sequencing) plays an important role in tumor research and tumor diagnosis. However, when applied to the detection of rare tumor mutation genes, the identification of tumor mutation drug resistance, and the evaluation of treatment response effects, the mutation frequency needs to be detected at 0.1% or lower. Since the standard library construction process uses DNA polymerase method to introduce background noise, ultra-low frequency mutation signals will be masked by background noise and difficult to distinguish. The main noise sources can be subdivided into thr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6806
CPCC12Q1/6806C12Q2531/113C12Q2537/143C12Q2525/191C12Q2535/122
Inventor陆利唐薇朱丽芳曹曼曼徐根明潘艺赵谦
OwnerHUNAN YEARTH BIOTECHNOLOGICAL CO LTD