Leucocytozoon caulleryi recombinant R7 protein and preparation method and application thereof

A recombinant protein and leukocyte technology, applied in biochemical equipment and methods, recombinant DNA technology, chemical instruments and methods, etc., can solve the problems of easy misdiagnosis, late appearance, and easy missed detection of blood smears, so as to reduce the difficulty. and cost, easy preparation, good detection effect

Pending Publication Date: 2020-01-14
FOSHAN STANDARD BIO TECH
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The merozoites appearing in the peripheral blood are extremely small, and it is difficult to distinguish the merozoites of Leukocytozoon carinii from other haematospora merozoites under an ordinary optical microscope, and it is easy to misdiagnose
In addition, the mature gametocytes of Leucocytosia carinii appear late in the peripheral blood and last for a short

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Leucocytozoon caulleryi recombinant R7 protein and preparation method and application thereof
  • Leucocytozoon caulleryi recombinant R7 protein and preparation method and application thereof
  • Leucocytozoon caulleryi recombinant R7 protein and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0062] Example 1

[0063] 1. Gene synthesis and gene cloning

[0064] (1) Find the R7 gene sequence of Leucococcus carinii, optimize the codons without changing the amino acid sequence, and then artificially synthesize the R7 gene sequence;

[0065] (2) Design a pair of linking primers R7S1-F / R7S1-R, according to the nucleotide sequence of the psYNO-1 plasmid and R7 gene, design a pair of identification primers R7S2-F / R7S2-R, the primer sequence is shown in Table 1, the connection The 5'end of the primer contains 15 bases homologous to the end of the expression plasmid vector psYNO-1, and the 3'end of the In-Fusion connection primer contains the specific primer sequence of the R7 gene;

[0066] (3) Using the synthesized R7 gene sequence as a template, PCR amplifies the R7 gene fragment.

[0067] Table 1 Primer design

[0068]

[0069] The 50μL PCR reaction system is shown in Table 2:

[0070] Table 2 PCR reaction system

[0071]

[0072] The PCR amplification program is:

[0073] The react...

Example Embodiment

[0075] Example 2

[0076] 1. Preparation method and expression of Leukocytosis recombinant R7 protein

[0077] (1) PCR amplification of the recombinant gene: Find the Leukocytosis Carinii R7 gene sequence, design a pair of specific amplification primers to PCR amplification of the Leukocytosis Carinii R7 gene, obtain the Leukocytosis recombinant R7 gene, so The nucleotide sequence of the pair of specific amplification primers is: CTGTACTTCCAGGGAGCAAGTGGTCTGGTTACC and GTGGTGGTGCTCGAGTTATCACACTTCTTCATGT, and the nucleotide sequence of a pair of identification primers is GACTAATTCGAGCTCGAACAACAACA and CATGTTCTTCTTTTTCTTTCTCTTCGTG;

[0078] (2) Construction of the recombinant expression vector psYNO-R7: digest the psYNO-1 plasmid with restriction enzymes BamH Ⅰ and Xho Ⅰ, connect the recombinant R7 gene to the digested psYNO-1 plasmid with ligase and transform it In E.coli TOP10 competent cells, perform PCR to identify positive clones, obtain PCR-identified positive bacterial liquid, ex...

Example Embodiment

[0132] Example 3

[0133] 1. Purification of recombinant protein

[0134] Purification of Leukocytosis recombinant R7 protein: the overnight cultured bacteria solution was inoculated into 200mL LK liquid medium at a ratio of 1:100, and cultured at 37℃, 210rpm shaking for 2h, until the bacteria solution OD600nm=0.6- 0.8. Under 37°C, 210rpm and IPTG induction, carry out the large-scale expression of Leukocytosis recombinant R7 protein, collect the induced expression bacteria; place the induced bacteria liquid on ice, then centrifuge in a centrifuge, and discard Clear liquid, collect the bacteria, resuspend the bacteria with MBP (maltose binding protein) binding solution, ultrasonically lyse the bacteria with an ultrasonic cell pulverizer, collect the supernatant, and then add MBP purification resin (Changzhou Tiandi Renhe Biotechnology Co., Ltd. The product DextrinBeads 6FF) was purified and filtered to obtain the recombinant R7 protein of Leucocyte Carinii.

[0135] (1) Sample prepa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of biotechnology, and discloses a leucocytozoon caulleryi recombinant R7 protein and a preparation method thereof. The amino acid sequence of the leucocytozoon caulleryi recombinant R7 protein is MBP-R7. A leucocytozoon caulleryi recombinant R7 gene is artificially synthesized and the leucocytozoon caulleryi recombinant R7 protein is prepared. After an expressionproduct is purified and subjected to activity detection in vitro, it is found that the leucocytozoon caulleryi recombinant R7 protein has the function of detecting antibodies to leucocytozoon caulleryi, the recombinant R7 protein is used instead of a second-generation schizont as a coating antigen in the detection of the leucocytozoon caulleryi disease, the detection effect is better, and the detection is faster and more convenient; and since the recombinant R7 protein is easier to prepare, the difficulty and cost of antigen acquisition are reduced.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a recombinant R7 protein of Leucocystis carinii and a preparation method thereof. Background technique [0002] Leukocytozoon cariniiosis, also known as "white crown disease", is a blood sporidiosis caused by Leukocytosis carinii parasitizing in the red blood cells, white blood cells and visceral tissue cells of chickens. Leukocytosis in chickens mostly occurs in chicks aged 3 to 6 weeks, with severe disease and high mortality; the infection rate of young chickens is higher than that of chicks, but the mortality rate is not high; the infection rate of adult chickens is the highest, but the mortality rate is very high low, milder symptoms. The main clinical symptoms are pale combs, emaciation, watery white or green feces, stunted growth of chickens, decline or even stop of egg production in adult chickens, which will cause great economic losses to the chicken industry. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/44C12N15/70G01N33/68G01N33/569
CPCC07K14/44C12N15/70G01N33/6854G01N33/56905C12N2800/22G01N2469/20
Inventor 邝春曼谭志坚黄仪娟刘丽丹翁亚彪王新秋
Owner FOSHAN STANDARD BIO TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap