Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Leucocytozoon caulleryi recombinant R7 protein and preparation method and application thereof

A recombinant protein and leukocyte technology, applied in biochemical equipment and methods, recombinant DNA technology, chemical instruments and methods, etc., can solve the problems of easy misdiagnosis, late appearance, and easy missed detection of blood smears, so as to reduce the difficulty. and cost, easy preparation, good detection effect

Pending Publication Date: 2020-01-14
FOSHAN STANDARD BIO TECH
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The merozoites appearing in the peripheral blood are extremely small, and it is difficult to distinguish the merozoites of Leukocytozoon carinii from other haematospora merozoites under an ordinary optical microscope, and it is easy to misdiagnose
In addition, the mature gametocytes of Leucocytosia carinii appear late in the peripheral blood and last for a short time, so the blood smear examination is easy to miss
Although the blood smear inspection method is simple and feasible, it has great limitations in terms of detection efficiency, detection rate, and identification of insect species. It is increasingly unsuitable for the current prevention and control work, especially for large-scale epidemics. scientific survey

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Leucocytozoon caulleryi recombinant R7 protein and preparation method and application thereof
  • Leucocytozoon caulleryi recombinant R7 protein and preparation method and application thereof
  • Leucocytozoon caulleryi recombinant R7 protein and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] 1. Gene synthesis and gene cloning

[0064] (1) Find the R7 gene sequence of Leukocystis carinii, optimize the codon without changing the amino acid sequence, and then artificially synthesize the R7 gene sequence;

[0065] (2) Design a pair of connection primers R7S1-F / R7S1-R, and design a pair of identification primers R7S2-F / R7S2-R according to the nucleotide sequence of the psYNO-1 plasmid and the R7 gene. The primer sequences are shown in Table 1. The 5' end of the primer contains 15 bases homologous to the end of the expression plasmid vector psYNO-1, and the 3' end of the In-Fusion connection primer contains the R7 gene-specific primer sequence;

[0066] (3) Using the synthesized R7 gene sequence as a template, PCR amplifies the R7 gene fragment.

[0067] Table 1 Primer design

[0068]

[0069] The 50 μL PCR reaction system is shown in Table 2:

[0070] Table 2 PCR reaction system

[0071]

[0072] The PCR amplification program is:

[0073] The reaction...

Embodiment 2

[0076] 1. Preparation method and expression of the recombinant R7 protein of Leukocystis carinii

[0077] (1) PCR amplification of the recombinant gene: find the sequence of the R7 gene of Leukocystis carinii, design a pair of specific amplification primers to perform PCR amplification on the R7 gene of Leukocia carinii, and obtain the recombinant R7 gene of Leukocystis carinii. The nucleotide sequence of the pair of specific amplification primers is: CTGTACTTCCAGGGAGCAAGTGGTCTGGTTACC and GTGGTGGTGCTCGAGTTATCACACTTCTTCATGT, and the nucleotide sequence of another pair of identification primers is GACTAATTCGAGCTCGAACAACAACA and CATGTTCTTCTTTTTCTTCTCTTCGTG;

[0078] (2) Construction of recombinant expression vector psYNO-R7: Digest the psYNO-1 plasmid with restriction enzymes BamH Ⅰ and Xho Ⅰ, connect the recombinant R7 gene and the digested psYNO-1 plasmid with ligase, and transform into E.coli TOP10 competent cells, and then perform PCR identification of positive clones to obta...

Embodiment 3

[0133] 1. Purification of Recombinant Proteins

[0134] Purification of the recombinant R7 protein of Leucocystis carinii: Inoculate the overnight cultured bacterial solution in 200mL LK liquid medium at a ratio of 1:100, culture at 37°C with shaking at 210rpm for 2 hours, until the bacterial solution OD600nm=0.6- 0.8, under 37℃, 210rpm and IPTG induction, a large amount of expression of the recombinant R7 protein of Leucocystis carinii was carried out, and the induced expression bacteria were collected; the induced bacterial solution was placed on ice, then centrifuged in a centrifuge, and discarded Supernatant, collect the bacteria, resuspend the bacteria with MBP (maltose-binding protein) binding solution, use an ultrasonic cell pulverizer to ultrasonically lyse the bacteria, collect the supernatant, and then add MBP purification resin (Changzhou Tiandi Renhe Biotechnology Co., Ltd. The product DextrinBeads 6FF) was purified and filtered to obtain the recombinant R7 protein...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and discloses a leucocytozoon caulleryi recombinant R7 protein and a preparation method thereof. The amino acid sequence of the leucocytozoon caulleryi recombinant R7 protein is MBP-R7. A leucocytozoon caulleryi recombinant R7 gene is artificially synthesized and the leucocytozoon caulleryi recombinant R7 protein is prepared. After an expressionproduct is purified and subjected to activity detection in vitro, it is found that the leucocytozoon caulleryi recombinant R7 protein has the function of detecting antibodies to leucocytozoon caulleryi, the recombinant R7 protein is used instead of a second-generation schizont as a coating antigen in the detection of the leucocytozoon caulleryi disease, the detection effect is better, and the detection is faster and more convenient; and since the recombinant R7 protein is easier to prepare, the difficulty and cost of antigen acquisition are reduced.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a recombinant R7 protein of Leucocystis carinii and a preparation method thereof. Background technique [0002] Leukocytozoon cariniiosis, also known as "white crown disease", is a blood sporidiosis caused by Leukocytosis carinii parasitizing in the red blood cells, white blood cells and visceral tissue cells of chickens. Leukocytosis in chickens mostly occurs in chicks aged 3 to 6 weeks, with severe disease and high mortality; the infection rate of young chickens is higher than that of chicks, but the mortality rate is not high; the infection rate of adult chickens is the highest, but the mortality rate is very high low, milder symptoms. The main clinical symptoms are pale combs, emaciation, watery white or green feces, stunted growth of chickens, decline or even stop of egg production in adult chickens, which will cause great economic losses to the chicken industry. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/44C12N15/70G01N33/68G01N33/569
CPCC07K14/44C12N15/70G01N33/6854G01N33/56905C12N2800/22G01N2469/20
Inventor 邝春曼谭志坚黄仪娟刘丽丹翁亚彪王新秋
Owner FOSHAN STANDARD BIO TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com