Application of segment of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular spines
A technology of nucleotide sequence and intermuscular spines, which is applied in the field of molecular biology, can solve the problem of unscreened gene information, etc., and achieve the effect of remarkable trait improvement, low cost, and short breeding time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Use of an isolated nucleotide sequence in the construction of zebrafish with reduced spines:
[0026] 1.1 Experimental materials
[0027] Wild-type zebrafish (eGFP:sp7) (Liang et al., 2019) were reared in the recirculating culture system of the Fisheries College of Huazhong Agricultural University, with a water temperature of 28°C and a day-to-night ratio of 14:10. Embryos used for zebrafish microinjection were obtained from natural spawning of male and female zebrafish.
[0028] 1.2 Experimental method
[0029] 1.2.1 Determination of sgRNA target sites
[0030] Determine the sgRNA target site as: 5'GGGTGGCGGACGGCTGAT'3.
[0031] 1.2.2 Synthesis of sgRNA in vitro
[0032]Overlap PCR amplification was carried out using upstream primers (Guide Oligo: 5’TGTAATACGACTCACTATAGGACAAAACCTCTGACCTGTGGTTTTGAGCTAGAAATAGC) with T7 promoter, specific target sequence and complementary ends and conserved downstream primers (scaffold: 5’GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



