Application of segment of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular spines

A technology of nucleotide sequence and intermuscular spines, which is applied in the field of molecular biology, can solve the problem of unscreened gene information, etc., and achieve the effect of remarkable trait improvement, low cost, and short breeding time

Active Publication Date: 2020-01-14
HUAZHONG AGRI UNIV
View PDF7 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing studies have also explored molecular genetic information related to the development and number of intermuscular spines (Wan et al., 2016; Nie et al., 2017; Wan et al., 2017; Nie et al., 2018; Wan et al., 2019), provided the genetic data basis for the study of intermuscular spines, but did not screen out the genetic information directly related to the number of intermuscular spines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of segment of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular spines
  • Application of segment of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular spines
  • Application of segment of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular spines

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Use of an isolated nucleotide sequence in the construction of zebrafish with reduced spines:

[0026] 1.1 Experimental materials

[0027] Wild-type zebrafish (eGFP:sp7) (Liang et al., 2019) were reared in the recirculating culture system of the Fisheries College of Huazhong Agricultural University, with a water temperature of 28°C and a day-to-night ratio of 14:10. Embryos used for zebrafish microinjection were obtained from natural spawning of male and female zebrafish.

[0028] 1.2 Experimental method

[0029] 1.2.1 Determination of sgRNA target sites

[0030] Determine the sgRNA target site as: 5'GGGTGGCGGACGGCTGAT'3.

[0031] 1.2.2 Synthesis of sgRNA in vitro

[0032]Overlap PCR amplification was carried out using upstream primers (Guide Oligo: 5’TGTAATACGACTCACTATAGGACAAAACCTCTGACCTGTGGTTTTGAGCTAGAAATAGC) with T7 promoter, specific target sequence and complementary ends and conserved downstream primers (scaffold: 5’GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology, and discloses application of a segment of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular spines. The nucleotide sequence is shown as SEQ ID NO.1, by using a conventional method in the field, the SEQ ID NO.1 is taken as a target gene to perform gene mutation operation, F0 with mutation is screened out, F1 generated by hybridization of F0 and a wild type is subjected to genotyping, and mutant F1 is screened out and selfed, so that the zebra fish strain with few intramuscular spines which is remarkablyreduced by more than 70% in the number of intramuscular spines and is stably inherited can be obtained. According to the application of the segment of isolated nucleotide sequence in construction ofzebra fish with reduced intramuscular spines, the segment of isolated nucleotide sequence is used to obtain a fish strain with reduced intramuscular spines for the first time, and the application of the segment of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular spines has the advantages of remarkable character improvement effect, short breeding time, stable heredity, low cost and the like, has the basic value and the application value of scientific research, can be used for researching the development mechanism of the intramuscular spines of the fish, andprovides a method for obtaining a stable genetic strain with few intramuscular spines of various fish.

Description

technical field [0001] The invention belongs to the field of molecular biology, and specifically relates to the application of an isolated nucleotide sequence in the construction of zebrafish with reduced intermuscular spines. By mutating the nucleotide sequence, zebrafish intermuscular spines can be reduced and simultaneously obtained Stably inherited zebrafish mutants with reduced intermuscular spines. Background technique [0002] The intermuscular bone is a needle-like skeleton that only exists in the muscles of lower teleosts, and is a membranous bone derived from the continuous homologous ossification of the connective tissue of the diaphragm (Patterson and Johnson, 1995; Danos and Ward ,2012). Almost half of the main farmed fishes in the world belong to Cypriniformes, and these fishes all have a certain number of intermuscular spines, such as crucian carp (Carassius carassius), grass carp (Ctenopharyngodonidella), silver carp (Hypophthalmichthys molitrix), etc. Cypr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/113A01K67/027
CPCA01K67/0276A01K2207/15A01K2217/075A01K2227/40A01K2267/02C07K14/461C12N15/113C12N2310/20
Inventor高泽霞万世明聂春红陈宇龙
OwnerHUAZHONG AGRI UNIV