Unlock instant, AI-driven research and patent intelligence for your innovation.

Lipid hydroperoxide lyase, as well as gene and application thereof

A lipid hydroperoxide and lyase technology, applied in the field of lyase gene, can solve the problem that the mechanism of aroma components in black tea is not completely clear

Active Publication Date: 2020-01-24
ANHUI AGRICULTURAL UNIVERSITY
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The specific aroma components of black tea are significantly increased compared with fresh leaves, but the mechanism of the aroma components of black tea is not completely clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lipid hydroperoxide lyase, as well as gene and application thereof
  • Lipid hydroperoxide lyase, as well as gene and application thereof
  • Lipid hydroperoxide lyase, as well as gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0042] Experimental example 1 Differences in the expression of lipid hydroperoxide lyase genes CsHPL1 and CsHPL3 in different tissues of Shuchazao and black tea during processing

[0043]1. Expression differences of lipid hydroperoxide lyase genes CsHPL1 and CsHPL3 in different tissues of Shuchazao

[0044] The roots, stems, flowers, fruits, buds, first leaf, second leaf, and third leaf of Shucha early plants were picked respectively, and the expression levels of CsHPL1 and CsHPL3 in each sample were detected by high-throughput sequencing method, as shown in image 3 Shown is the histogram of the expression levels of CsHPL1 and CsHPL3 in different tissues of the present invention, image 3 A is the expression level of CsHPL1 in each sample, image 3 Middle B is the expression level of CsHPL3 in each sample. In the figure, L1 means one leaf, L2 means two leaves, L3 means three leaves, FL means flower, FR means fruit, S means stem, R means root, B means bud, you can see It was...

experiment example 2

[0047] Experimental example 2 Cloning of lipid hydroperoxide lyase genes CsHPL1 and CsHPL3

[0048] 1. Preparation of DH5α Escherichia coli containing gene CsHPL1 or CsHPL3 sequence

[0049] (1) Specific primers

[0050] The specific primer sequence of CsHPL1 is as follows (the underlined part is the restriction enzyme cutting site):

[0051] F (SEQ ID NO.5):

[0052] C GGATCC ATGTCGGCAGTGATGGCGAAAATG BamH1

[0053] R (SEQ ID NO.6):

[0054] G GAATTC TCACTTAGCTTTTTCGACGGC EcoR1

[0055] The specific primer sequence of CsHPL3 is as follows (the underlined part is the restriction enzyme cutting site):

[0056] F (SEQ ID NO. 7):

[0057] T GGATCC ATGGAGGCCATCTCACTGTCTCT BamH1

[0058] R (SEQ ID NO. 8):

[0059] C AAGCTT CTAGCACGCTTGGAGGCGAATT Hind3

[0060] (2) According to the instructions of Plant Total RNA Extraction Kit and First Strand cDNA Synthesis Kit (purchased from TIANGEN, Cat#DP441), extract the total RNA of the tea tree sample, and reverse transcribe...

experiment example 3

[0074] Experimental Example 3 Preparation of recombinant bacteria containing CsHPL3 and expression and purification of target protein

[0075] 1. Preparation of recombinant bacteria containing CsHPL3

[0076] The recombinant plasmid CsHPL3-PET28A constructed in Experimental Example 2 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacterium A; the pET-28a (+) vector was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacterium B; The recombinant plasmid CsHPL3-PB2GW7 constructed in was introduced into Agrobacterium GV3101 to obtain recombinant bacterium C; the PB2GW7(+) vector was introduced into Agrobacterium GV310 to obtain recombinant bacterium C.

[0077] 2. Expression and purification of the target protein in recombinant bacteria A and B

[0078] Inoculate the above-mentioned recombinant bacteria A and B into the liquid LB medium containing 50 mg / L kanamycin, culture at 37°C with shaking at 180 rpm until OD 600nm = 0.6. Then, IPT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses lipid hydroperoxide lyase, as well as a gene and application thereof. The gene has a nucleotide sequence as shown in SEQ ID NO.1, or has a nucleotide sequence as shown in SEQ ID NO.3. The lyase gene provided by the invention can regulate and control the contents of volatile matters and jasmonic acid matters in plants, and participates in a tea leaf processing process; the expression of the lyase gene is used for improving the generation of the grass-flavor C6-C9 volatility in the plants; and the inhibition of the lyase gene is used for improving the contents of jasmonicacid premise matters and the jasmonic acid matters.

Description

technical field [0001] The invention relates to a lyase gene, in particular to a lipid hydroperoxide lyase, gene and application thereof. Background technique [0002] The sensory evaluation of black tea is mainly in terms of color, aroma, and taste, and aroma, as one of the important indicators of tea sensory evaluation, has an important judgment-oriented function for tea drinkers and consumers, and is often used as a criterion for classifying the quality of black tea. index. [0003] Black tea is a fully fermented tea. During the fermentation process, tea polyphenols are enzymatically oxidized to generate theaflavins (TFs) and thearubigins (Thearubigins), so black tea has the characteristics of black tea, red soup, red leaves and sweet and mellow Characteristics. The specific aroma substances of black tea are significantly increased compared with fresh leaves, but the mechanism of the aroma components of black tea is not completely clear. [0004] At present, studies ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/60C12N9/88C12N15/11C12Q1/6895
CPCC12N9/88C12Q1/6895C12Q2600/13C12Q2600/158
Inventor 赵剑张高阳崔单单赵丹丹
Owner ANHUI AGRICULTURAL UNIVERSITY