Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A primer-probe composition, kit and application for detecting soybean root rot based on recombinase polymerase amplification method

A technology of recombinase polymerase and primer probe, which is applied in the field of genetic engineering, can solve the problems of poor specificity, long cycle and low sensitivity of detection methods, and achieve the effect of convenient operation, fast detection speed and cumbersome operation

Active Publication Date: 2022-07-15
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the problems of long period, poor specificity and low sensitivity of the Pythium ultimate biological detection method in the prior art, the purpose of the present invention is to provide a primer detection method for detecting Pythium ultimate based on a recombinase polymerase amplification method. Needle composition, kit and application thereof

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A primer-probe composition, kit and application for detecting soybean root rot based on recombinase polymerase amplification method
  • A primer-probe composition, kit and application for detecting soybean root rot based on recombinase polymerase amplification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Design, screening and validation of specific primer and probe compositions for Pythium ultimum

[0027] In order to obtain the specific primer and probe composition of Pythium ultimum, the present invention firstly downloads Pythium ultimum and more than 20 other Pythium species from the NCBI database based on the bioinformatics analysis tool, using the commonly used ITS sequence as the detection target Through multiple sequence alignment analysis, specific primer compositions were designed in the regions with obvious sequence differences between Pythium ultimum and other Pythium, and 3 groups of primer compositions were preliminarily selected from the designed primer compositions. Composition 1: F1 (TTCACGATGTATGGAGACGCTGCATTTAGTTG), R1 (TCCTCCGCTTATTGATATGCTTAAGTTCAG); primer composition 2: F2 (TTTCAGCAGTGGATGTCTAGGCTCGCACATCG), R2 (GATTCTCGATCGAAAAAACGAACGCAACCAT); For the above three groups of primer compositions, the common PCR method was used to screen ...

Embodiment 2

[0028]Example 2: Specificity test of primer and probe composition of Pythium ultimum

[0029] Primer and probe combination for detection of Pythium ultimum: the forward primer has the nucleotide sequence of PuRPA-F as shown in SEQ ID No. 1 and the reverse primer has the PuRPA as shown in SEQ ID No. 2 -R nucleotide sequence, the probe has the PuProbe nucleotide sequence as shown in SEQ ID No.3.

[0030] Forward primer PuRPA-F: TTCACGATGTATGGAGACGCTGCATTTAGTTG

[0031] Reverse primer PuRPA-R: Biotin-TCCTCCGCTTATTGATATGCTTAAGTTCAG

[0032] Probe PuProbe: FAM-TATCATTGTCAATTGCAAGATTGTGTATGG-THF-ATCTCAATTGGACCT-C3 spacer

[0033] The above-mentioned primer and probe combination was used to make a kit. The concentration and dosage of each reagent in the kit were: 2.1 μL 10 μM forward primer PuRPA-F, 2.1 μL 10 μM reverse primer PuRPA-R, 0.6 μL 10 μM of the probe PuProbe, 29.5 μL of Rehydration Buffer, 12.2 μL of DEPC-treated water, 2.5 μL of 280 mM MgAC and dry enzyme powder were m...

Embodiment 3

[0036] Example 3: Sensitivity test for detection of Pythium ultimum recombinase polymerase

[0037] In order to determine the sensitivity of the recombinase polymerase detection method, the genomic DNA of Pythium ultimum was measured with a spectrophotometer and then diluted by 10-fold gradient. The DNA concentration range was set to 1ng-10fg. 1 μL was used as a template, DEPC-treated water was used as a negative control, and 49 μL of the kit solution was added to carry out the recombinase polymerase amplification reaction. The reaction program was: incubation at 39°C for 20 min. After the reaction is completed, use lateral flow chromatography test strips to detect the amplification products, and judge the detection results according to the color change of the indicator band of the detection line. The results show that: DNA concentration in the range of 1ng-100fg can observe the strip at the detection line of the test strip, the DNA concentration is 10fg and the negative contr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer-probe composition for detecting Pythium ultimum based on a recombinase polymerase amplification method, a kit and an application thereof. The primer-probe composition consists of a forward primer PuRPA-F, a reverse primer PuRPA- R and probe PuProbe are composed, the forward primer PuRPA-F has the nucleotide sequence shown in SEQ ID No.1, and the reverse primer PuRPA-R has the nucleotide sequence shown in SEQ ID No.2 sequence, the probe PuProbe has the nucleotide sequence shown in SEQ ID No.3. Compared with the traditional detection technology for identifying Pythium ultimum based on morphological characteristics, the invention has higher accuracy, sensitivity and practicality, and is easy to operate and has good practicability, and provides a new technology for the detection of Pythium ultimum. A platform for high-sensitivity and rapid detection of soybean root rot caused by Pythium ultimum.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a primer-probe composition, a kit and applications for detecting soybean root rot caused by Pythium ultimum based on a recombinase polymerase amplification method. Background technique [0002] Pythium ultimum is a common soil-borne pathogen and one of the most virulent genus Pythium, which can infect a large number of commercial crops, including wheat, corn, soybean, potato, tomato, etc. Soybean root rot caused by Pythium ultimum causes severe losses in soybean production. Therefore, the molecular detection of Pythium ultimum is of great significance to crop diseases in agricultural production. Rapid and accurate detection can provide reference for disease control, effectively utilize the best control period and reduce losses. [0003] The detection of Pythium is a key step in disease prevention and control. Traditional detection methods are based on the microscop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/6844C12Q1/6804C12Q1/04C12N15/11C12R1/645
CPCC12Q1/6895C12Q1/6844C12Q1/6804C12Q2521/507C12Q2563/107C12Q2563/131C12Q2565/625
Inventor 窦道龙沈丹宇张正光张海峰逯欣宇
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com