Fungus secretory expression vector as well as construction method and application thereof

A technology for secretion expression and expression vectors, which is applied in the field of fungal secretion expression vectors, which can solve the problems of target protein residues, inability to effectively cut and secrete proteins, and difficult development, etc., and achieve the effect of rapid identification

Active Publication Date: 2020-03-31
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Traditional plant transgenic technology can identify the function of plant genes, use signal peptides to construct secretory expression vectors to express foreign genes, and secrete target proteins outside the cells, which is conducive to the effective identification of plant gene functions. The construction process of the secretory expression vector is cumbersome and has certain limitations. For immature transgenic plants such as bananas, this work is even more difficult to carry out.
At present, in the process of constructing expression vectors, it is often prone to ineffective protein cleavage and secretion, or leaving a long sequence at the N-terminal of the target protein, which will affect the function of the target protein and fail to achieve the successful expression of the target protein in fungi. expressed in and secreted into plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fungus secretory expression vector as well as construction method and application thereof
  • Fungus secretory expression vector as well as construction method and application thereof
  • Fungus secretory expression vector as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 - Determination of extracellular signal peptide and design of a short sequence comprising an enzyme cleavage site

[0037] 1. The present invention identifies a highly abundant secreted protein Six1d from Fusarium oxysporum Cuban specialization type No. 1 race (Foc1) through secretome proteomics, and predicts the protein sequence N through signal peptide analysis There is a 21aa extracellular signal peptide at the end, protein cleavage and secretion can be achieved between 21aa and 22aa, and the 23aa or even 30aa at the N-terminus cannot be predicted to be effectively cleaved when used alone, although the protein N-terminal 40aa and The 50aa sequence can realize protein cleavage and secretion, but when the vector constructed with the 40aa or 50aa sequence is used, a longer sequence will be left at the N-terminal of the target protein, which will affect the function of the target protein.

[0038] 2. The specific experiment is as follows:

[0039] (1) Using th...

Embodiment 2

[0054] Embodiment 2-a method for constructing a fungal secretion expression vector, comprising the steps of:

[0055] (1) Through signal peptide analysis, it was determined that the secretory signal peptide sequence was the extracellular signal peptide of Six1d protein N-terminal 23aa (MAPYSMVLLGALSILGFGAYAQE), and the nucleotide sequence was: ATGGCGCCCTATAGCATGGTACTCCTTGGCGCCCCTCTCAATCCTTGGGTTTGGGGCTT ATGCTCAAGAG; and designed a short sequence of the enzyme cleavage site, nucleotide sequence It is: GATATCCATATGGCTAGCAGGCCT; the short sequence of the enzyme cutting site includes four restriction enzyme sites of EcoRV, NdeI, NheI and StuI;

[0056] (2) Use a nucleic acid synthesizer to synthesize a vector sequence comprising a signal peptide and a short sequence of restriction sites;

[0057] (3) The vector sequence containing the signal peptide and the short sequence of the restriction site was connected to the pCT74 vector by T4-DNA ligase to obtain the fungal secretory expre...

Embodiment 3

[0058] Embodiment 3 - a method for constructing a fungal secretion and expression exogenous gene system, comprising the following steps:

[0059] (1) Connect the exogenous EGFP gene into the fungal secretory expression vector 74HSP through NheI and StuI restriction enzymes in the short sequence of the restriction site to obtain a complete 74HSP-EGFP recombinant vector;

[0060] (2) The 74HSP-EGFP recombinant vector was transformed into Fusarium oxysporum Foc4 to obtain the FOC 4 transformant transformed with the pCT74-S secretory vector.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fungus secretory expression vector as well as a construction method and application thereof. The fungus secretory expression vector is a fungus secretory expression vector 74HSP formed by inserting extracellular signal peptide of a Six1d secretory protein N-terminal 23aa (MAPYSMVLLGALSILGFGAYAQE) into a 4665bp position of a pCT74 vector. According to the invention, a fungus secretory expression vector capable of effectively secreting plant protein to the outside of the pathogenic bacteria cell is successfully constructed and the target protein is effectively expressedin fungus and secreted into the plant in the infection process, so that the rapid identification of the plant gene function is realized.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a fungal secretion expression vector, a construction method and application thereof. Background technique [0002] Traditional plant transgenic technology can identify the function of plant genes, use signal peptides to construct secretory expression vectors to express foreign genes, and secrete target proteins outside the cells, which is conducive to the effective identification of plant gene functions. The construction process of the secretory expression vector is cumbersome and has certain limitations. For immature transgenic plants such as bananas, this work is even more difficult to carry out. At present, in the process of constructing expression vectors, it is often prone to ineffective protein cleavage and secretion, or leaving a long sequence at the N-terminal of the target protein, which will affect the function of the target protein and fail to achieve the successful expres...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/80C12N15/62C07K19/00C12N1/15C12R1/77
CPCC07K14/415C07K2319/02C12N15/80
Inventor王丹仝征彭存智常丽丽徐兵强
OwnerINST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI