Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant pichia pastoris engineering bacterium containing high-copy-number egg white lysozyme gene and application thereof

A technology of egg white lysozyme and Pichia pastoris, applied in genetic engineering, application, plant genetic improvement, etc., can solve the problems of high cost, small scale, unfavorable large-scale production and application, etc.

Inactive Publication Date: 2020-04-17
ZHEJIANG SILVER ELEPHANT BIO ENG +1
View PDF19 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this direct extraction production method is small in scale and high in cost, which is not conducive to large-scale production and application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant pichia pastoris engineering bacterium containing high-copy-number egg white lysozyme gene and application thereof
  • Recombinant pichia pastoris engineering bacterium containing high-copy-number egg white lysozyme gene and application thereof
  • Recombinant pichia pastoris engineering bacterium containing high-copy-number egg white lysozyme gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Synthesis of egg white lysozyme gene ewlyz derived from Gallus gallus and construction of pPIC9K-ewlyz plasmid

[0046] According to the amino acid sequence (SEQ ID NO.2) of egg white lysozyme (SEQ ID NO.2) derived from red jungle fowl (Gallus gallus) with GenBank Protein ID of NCBI database AAL69327, the codon preference of Pichia pastoris was optimized to obtain its nucleotide sequence ( SEQ ID NO.1), was synthesized by Wuxi Huada Qinglan Biotechnology Co., Ltd., and the gene was cloned between EcoRI and NotI of pPIC9K to obtain the recombinant plasmid pPIC9K-ewlyz, such as figure 1 As indicated, it was transformed into E.coli DH5α strain to obtain E.coli DH5α(pPIC9K-ewlyz) recombinant strain.

Embodiment 2

[0047] Example 2 Construction of Pichia pastoris recombinant bacteria expressing egg white lysozyme

[0048] After the linearized pPIC9K-ewlyz plasmid was transformed into Pichia pastoris GS115, the resistant strains were screened on a high-concentration G418 plate, and then the strains with high egg white lysozyme production were screened on a lysozyme plate, and finally secreted by the Erlenmeyer flask shake flask experiment. Recombinant Pichia pastoris expressing egg white lysozyme.

[0049] The specific implementation plan is as follows:

[0050] ① Linearize the pPIC9K-ewlyz plasmid. The strain E.coli DH5α (pPIC9K-ewlyz) was inoculated into LB medium containing 100 μg / mL ampicillin, cultured overnight at 37°C, and the pPIC9K-ewlyz plasmid was extracted using a plasmid extraction kit; the restriction enzyme SacI was used to Cut the plasmid pPIC9K-ewlyz to make it linearized, and perform gel recovery on the digested product, and purify the linearized plasmid and dissolve i...

Embodiment 3

[0080] Example 3 Constructing the recombinant plasmid pPICZα-EWlyz4 with multiple copies of egg white lysozyme

[0081] Based on the pPICZαA plasmid, after four steps of assembly, the recombinant plasmid pPICZα-EWlyz4 containing four copies of the egg white lysozyme gene reading frame was constructed, such as figure 2 shown. The specific operation method is as follows:

[0082] ①Clone EWlyz-TT between the EcoRI and BsmBI of pPICZαA to obtain the recombinant plasmid pPICZα-EwlyzTT, the specific operation is as follows: first extract the pPICZαA plasmid, perform double enzyme digestion with EcoRI and BsmBI, and gel recovery and purification; use primer EwlyzTT-1 -F: gagaggctgaagctgaattcaaggtctttggtcgttgtgaattg and EwlyzTT-1-R: CTCGAGGTACCGATCCGAGACGACTTCTCACTTAATTCTTCTG, using the plasmid pPIC9k-EWlyz as the DNA template, using the high-efficiency enzyme Phanta Max Super-Fidelity DNA from Vazyme Biotech Co., Ltd. Perform PCR amplification with Polymerase to obtain the EWlyz-T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant pichia pastoris engineering bacterium containing a high-copy-number egg white lysozyme gene and application thereof. The pichia pastoris engineering bacterium isobtained by integrating the lysozyme gene shown in SEQ ID NO.1 into a pichia pastoris genome at a high copy number. According to the invention, two plasmid mediated recombinant bacterium constructionmethods are adopted to obtain a recombinant bacterium with a copy number of 13; the lysozyme produced by the recombinant bacteria has high enzyme activity, and the fermentation enzyme activity is 45-50KU / mL within 120-140h.

Description

[0001] (1) Technical field [0002] The invention constructs a recombinant Pichia pastoris containing a high copy number egg white lysozyme gene and its application for producing lysozyme. [0003] (2) Technical background [0004] Lysozyme is an effective antibacterial agent that specifically acts on the cell wall, destroys the β-1,4-glycosidic bond between N-acetylglucosamine and N-acetylmuramic acid in the cell wall, and decomposes insoluble mucopolysaccharides into soluble sugars Peptide, with bacteriolytic effect. Lysozyme has a wide range of sources in nature, and can be divided into four types of lysozymes: microorganisms, bacteriophages, plants and animals. Among them, animal lysozymes have high activity and are widely used. In 1992, the Food Additives Association of FAO / WTO announced that it is safe to use lysozyme in the food industry. The Ministry of Health of my country issued the No. 23 Announcement in 2010 to approve lysozyme and other substances as food additive...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/81C12N15/56C12N9/36C12R1/84
CPCC12N9/2462C12N15/815C12Y302/01017
Inventor 朱林江周斌陈小龙陈艺强陆跃乐朱勇刚陈翰驰
Owner ZHEJIANG SILVER ELEPHANT BIO ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com