Recombinant pichia pastoris engineering bacterium containing high-copy-number egg white lysozyme gene and application thereof
A technology of egg white lysozyme and Pichia pastoris, applied in genetic engineering, application, plant genetic improvement, etc., can solve the problems of high cost, small scale, unfavorable large-scale production and application, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 Synthesis of egg white lysozyme gene ewlyz derived from Gallus gallus and construction of pPIC9K-ewlyz plasmid
[0046] According to the amino acid sequence (SEQ ID NO.2) of egg white lysozyme (SEQ ID NO.2) derived from red jungle fowl (Gallus gallus) with GenBank Protein ID of NCBI database AAL69327, the codon preference of Pichia pastoris was optimized to obtain its nucleotide sequence ( SEQ ID NO.1), was synthesized by Wuxi Huada Qinglan Biotechnology Co., Ltd., and the gene was cloned between EcoRI and NotI of pPIC9K to obtain the recombinant plasmid pPIC9K-ewlyz, such as figure 1 As indicated, it was transformed into E.coli DH5α strain to obtain E.coli DH5α(pPIC9K-ewlyz) recombinant strain.
Embodiment 2
[0047] Example 2 Construction of Pichia pastoris recombinant bacteria expressing egg white lysozyme
[0048] After the linearized pPIC9K-ewlyz plasmid was transformed into Pichia pastoris GS115, the resistant strains were screened on a high-concentration G418 plate, and then the strains with high egg white lysozyme production were screened on a lysozyme plate, and finally secreted by the Erlenmeyer flask shake flask experiment. Recombinant Pichia pastoris expressing egg white lysozyme.
[0049] The specific implementation plan is as follows:
[0050] ① Linearize the pPIC9K-ewlyz plasmid. The strain E.coli DH5α (pPIC9K-ewlyz) was inoculated into LB medium containing 100 μg / mL ampicillin, cultured overnight at 37°C, and the pPIC9K-ewlyz plasmid was extracted using a plasmid extraction kit; the restriction enzyme SacI was used to Cut the plasmid pPIC9K-ewlyz to make it linearized, and perform gel recovery on the digested product, and purify the linearized plasmid and dissolve i...
Embodiment 3
[0080] Example 3 Constructing the recombinant plasmid pPICZα-EWlyz4 with multiple copies of egg white lysozyme
[0081] Based on the pPICZαA plasmid, after four steps of assembly, the recombinant plasmid pPICZα-EWlyz4 containing four copies of the egg white lysozyme gene reading frame was constructed, such as figure 2 shown. The specific operation method is as follows:
[0082] ①Clone EWlyz-TT between the EcoRI and BsmBI of pPICZαA to obtain the recombinant plasmid pPICZα-EwlyzTT, the specific operation is as follows: first extract the pPICZαA plasmid, perform double enzyme digestion with EcoRI and BsmBI, and gel recovery and purification; use primer EwlyzTT-1 -F: gagaggctgaagctgaattcaaggtctttggtcgttgtgaattg and EwlyzTT-1-R: CTCGAGGTACCGATCCGAGACGACTTCTCACTTAATTCTTCTG, using the plasmid pPIC9k-EWlyz as the DNA template, using the high-efficiency enzyme Phanta Max Super-Fidelity DNA from Vazyme Biotech Co., Ltd. Perform PCR amplification with Polymerase to obtain the EWlyz-T...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



