Supercharge Your Innovation With Domain-Expert AI Agents!

Method for constructing novel chimeric antigen receptor targeting dual target points of GPC3 and CD19

An antigen and single-chain antibody technology, applied in the field of cell therapy, can solve the problem that liver cancer cannot be cured.

Pending Publication Date: 2020-05-05
HRAIN BIOTECHNOLOGY CO LTD
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The GPC3-GC333 antibody in 15 patients was observed to have a significant therapeutic effect in the phase I clinical trial for the treatment of HCC. It is speculated that the naked antibody will not have a good effect on human liver cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing novel chimeric antigen receptor targeting dual target points of GPC3 and CD19
  • Method for constructing novel chimeric antigen receptor targeting dual target points of GPC3 and CD19

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1: Determination of MASK-GPC3-CD19-CAR-tEGFR gene sequence

[0068] The heavy chain and light chain variable region gene sequence information (GC33) of the anti-GPC3 antibody was searched from the NCBI website database, and the anti-CD19 antibody heavy chain and light chain variable region gene sequence information (FMC63) sequence was found on the website http: / / sg. Codon optimization is performed on idtdna.com / site to ensure that it is more suitable for human cell expression without changing the encoded amino acid sequence.

[0069] For the nucleotide and amino acid sequence information of each gene, see (SEQUUNCE ID NO.1-2)

[0070] The above sequences were connected in sequence, and different enzyme cutting sites were introduced at the junctions of each sequence to form the complete sequence information of the Mask-GPC3-CD19-IgG4-CD28-41BB-tEGFR gene.

Embodiment 2

[0071] Embodiment 2: the construction of the viral vector comprising the nucleic acid sequence of CAR molecule

[0072] The nucleotide sequence of the CAR molecule prepared in Example 1 was double digested with NotI (NEB) and EcoRI (NEB), connected and inserted into the NotI-EcoRI site of the retroviral RV vector through T4 ligase (NEB), and transformed into When the competent E.coli (DH5α) was obtained, the recombinant plasmid was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and the sequencing result was compared with the fitted Mask-GPC3–CD19-IgG4-CD28-41BB-tEGFR sequence for verification Is the sequence correct. The sequencing primers are:

[0073] Sense sequence: AGCATCGTTCTGTGTTGTCTC (SEQUENCE ID NO.3)

[0074] Antisense sequence: TGTTTGTCTTGTGGCAATACAC (SEQUUNCE ID NO.4)

[0075] After the sequencing was correct, the plasmid purification kit of Qiagen was used to extract and purify the plasmid, and the plasmid calcium phosphate method of the purifie...

Embodiment 3

[0077] Example 3: Retroviral packaging

[0078] 1. On the first day, the 293T cells should be less than 20 passages and not overgrown. Plate at 0.6*10^6 cells / ml, add 10ml of DMEM medium to a 10cm dish, mix the cells well, and culture overnight at 37 degrees.

[0079] 2. On the second day, the 293T cell confluency reaches about 90% for transfection (usually about 14-18 hours after plating); prepare the plasmid complex, the amount of various plasmids is 12.5ug for Retro backbone (MSCV), and 12.5ug for Gag-pol 10ug, VSVg is 6.25ug, CaCl 2 250ul,H 2 O is 1ml and the total volume is 1.25ml; Add HBS equal to the volume of the plasmid complex in another tube, and vortex for 20 seconds while adding the plasmid complex. Gently add the mixture to the 293T dish along the side, incubate at 37°C for 4 hours, remove the medium, wash with PBS, and re-add fresh preheated medium.

[0080] 3. Day 4: 48 hours after transfection, collect the supernatant and filter it with a 0.45um filter, st...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a chimeric antigen receptor targeting dual target points of GPC3 and CD19, and the purpose of the chimeric antigen receptor, and particularly provides a polynucleotide sequence. The polynucleotide sequence is selected from (1) a polynucleotide sequence containing an MASK coding sequence, a coding sequence of a GPC3 resistant single-chain antibody, a coding sequence of a CD19 resistant single-chain antibody, a coding sequence of a human IgG4 hinge region, a coding sequence of a human CD28 transmembrane region, a coding sequence of a human 41BB intracellular region, a coding sequence of a human CD3 zeta intracellular region, and a coding sequence of any fragments of EGFR containing ectodomain III and ectodomain IV; and (2) a sequence which is complementary with the polynucleotide sequence in the (1). The invention also provides pertinent fusion protein, a carrier containing the coding sequences, and the purposes of the fusion protein, the coding sequences and thecarrier. The prepared CART cells disclosed by the invention have a tEGFR assembly which has the effects of in vivo tracing and safely switch.

Description

technical field [0001] The invention belongs to the field of cell therapy, and in particular relates to a chimeric antigen receptor targeting GPC3 and CD19 and its use. Background technique [0002] Liver cancer is the fifth most prevalent tumor and the third most common cause of cancer-related death in the world (Bosch et al., Gastroenterology 127:S5-S16, 2004; El–Serag et al., Gastroenterology 132:2557 76, 2007). According to the American Cancer Society, hepatocellular carcinoma (HCC) accounts for approximately 75 percent of liver cancer cases, and symptoms of liver cancer often do not occur until advanced stages. Surgery is the standard treatment for liver cancer because this type of cancer does not respond well to most chemotherapy drugs. Therefore, there is an urgent need to develop new drugs with different mechanisms of action. [0003] Glypican 3 (GPC3) is a cell surface protein belonging to the heparan sulfate proteoglycan family. The GPC3 gene codes to produce a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N7/01C12N5/10A61K35/17A61P35/00
CPCC07K16/303C07K16/2803C07K14/7051C12N15/86C12N7/00A61K35/17A61P35/00C07K2319/02C07K2319/33C07K2317/622C12N2510/00C12N2740/10043C12N2740/10021
Inventor 王海鹰
Owner HRAIN BIOTECHNOLOGY CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More