Method for constructing novel chimeric antigen receptor targeting dual target points of GPC3 and CD19

An antigen and single-chain antibody technology, applied in the field of cell therapy, can solve the problem that liver cancer cannot be cured.

Pending Publication Date: 2020-05-05

HRAIN BIOTECHNOLOGY CO LTD

7 Cites 0 Cited by

AI-Extracted Technical Summary

Problems solved by technology

The GPC3-GC333 antibody in 15 patients was observed to have a significant therapeutic effect in the phase I clinical tr...

Abstract

The invention relates to a chimeric antigen receptor targeting dual target points of GPC3 and CD19, and the purpose of the chimeric antigen receptor, and particularly provides a polynucleotide sequence. The polynucleotide sequence is selected from (1) a polynucleotide sequence containing an MASK coding sequence, a coding sequence of a GPC3 resistant single-chain antibody, a coding sequence of a CD19 resistant single-chain antibody, a coding sequence of a human IgG4 hinge region, a coding sequence of a human CD28 transmembrane region, a coding sequence of a human 41BB intracellular region, a coding sequence of a human CD3 zeta intracellular region, and a coding sequence of any fragments of EGFR containing ectodomain III and ectodomain IV; and (2) a sequence which is complementary with the polynucleotide sequence in the (1). The invention also provides pertinent fusion protein, a carrier containing the coding sequences, and the purposes of the fusion protein, the coding sequences and thecarrier. The prepared CART cells disclosed by the invention have a tEGFR assembly which has the effects of in vivo tracing and safely switch.

Application Domain

Mammal material medical ingredientsImmunoglobulins +12

Technology Topic

CD3Ectodomain +15

Image

Examples

Experimental program(3)

Example Embodiment

[0067] Example 1: Determination of MASK-GPC3-CD19-CAR-tEGFR gene sequence

[0068] From the NCBI website database, search the anti-GPC3 antibody heavy chain and light chain variable region gene sequence information (GC33), and the anti-CD19 antibody heavy chain and light chain variable region gene sequence information (FMC63) sequence is on the website http://sg. Codon optimization is carried out on idtdna.com/site to ensure that it is more suitable for human cell expression without changing the coding amino acid sequence.

[0069] See (SEQUNCE ID NO.1-2) for nucleotide and amino acid sequence information of each gene

[0070] Connect the above sequences in sequence, and introduce different restriction sites at each sequence connection to form a complete Mask-GPC3–CD19-IgG4-CD28-41BB-tEGFR gene sequence information.

Example Embodiment

[0071] Example 2: Construction of a viral vector containing the nucleic acid sequence of the CAR molecule

[0072] The nucleotide sequence of the CAR molecule prepared in Example 1 was digested with NotI (NEB) and EcoRI (NEB), then inserted into the NotI-EcoRI site of the retroviral RV vector by T4 ligase (NEB), and transformed To competent E. coli (DH5α), send the recombinant plasmid to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing, and compare the sequencing result with the sequence of the proposed Mask-GPC3–CD19-IgG4-CD28-41BB-tEGFR to verify Is the sequence correct? The sequencing primers are:

[0073] Sense sequence: AGCATCGTTCTGTGTTGTCTC (SEQUNCE ID NO.3)

[0074] Antisense sequence: TGTTTGTCTTGTGGCAATACAC (SEQUNCE ID NO.4)

[0075] After correct sequencing, the plasmid was extracted and purified using Qiagen's plasmid purification kit. The purified plasmid was transfected into 293T cells by the calcium phosphate method for retrovirus packaging experiments.

[0076] The plasmid map constructed in this example is as follows figure 1 Shown.

Example Embodiment

[0077] Example 3: Retroviral packaging

[0078] 1. On day 1, 293T cells should be less than 20 passages and not overgrown. Plate the plate at 0.6*10^6cells/ml, add 10ml DMEM medium to a 10cm dish, mix the cells thoroughly, and incubate overnight at 37°C.

[0079] 2. On the second day, the 293T cell confluence reached about 90% for transfection (usually about 14-18h for plating); Prepare plasmid complex, the amount of various plasmids is 12.5ug for Retro backbone (MSCV), and Gag-pol is 10ug, VSVg is 6.25ug, CaCl 2 250ul, H 2 O is 1ml, the total volume is 1.25ml; add HBS equal to the volume of the plasmid complex in another tube, and vortex for 20s while adding the plasmid complex. Gently add the mixture to the 293T dish along the side, incubate at 37°C for 4 hours, remove the medium, wash it with PBS, and re-add the pre-warmed fresh medium.

[0080] 3. Day 4: Collect the supernatant after 48 hours of transfection and filter it with a 0.45um filter, and store it in aliquots at -80°C, continue to add pre-warmed fresh DMEM medium.

PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.