Artificially synthesized anti-insect protein mCry1Ia2 as well as preparation method and application thereof
An insect-resistant protein, artificially synthesized technology, applied in the field of genetic engineering and biological control, to achieve important economic value, reduce environmental pollution, and reduce the amount of use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1 Synthesis of mCry1Ia2 gene
[0054] Through codon optimization, Cry1Ab, Cry1F and Cry1Ie were synthesized (the synthesis work was completed by Jinweizhi (Suzhou) Co., Ltd.), and then the first and second functional domains of Cry1Ab, the second functional domain of Cry1Ab, and the The third functional domain and the three domain fragments of Cry1Ie are spliced together to form a new mCry1Ia2 DNA sequence with six domains, the nucleotide sequence of which is shown in SEQ ID NO.1. It is generally believed that: Bt protein is composed of three structural domains, domain I includes 250-300 amino acids at the N-terminal of the active insecticidal protein, and consists of seven α-helices, one of which is relatively hydrophobic and located in the structural domain Ⅰ center, surrounded by the remaining 6 α-helices. It has been proven that it is related to the toxicity of insecticidal proteins. The hydrophobic α-helix has the ability to insert into the midgut cell m...
Embodiment 2
[0055] Example 2 Expression of mCry1Ia2 gene in prokaryotic system and detection of product toxicity
[0056] In order to detect the in vitro expression of the modified mCry1Ia2 gene and its toxicity to the corn borer, we constructed a Bt prokaryotic expression vector. As required, add the NdeI endonuclease recognition site sequence AAGGAGATATACATA at the 5' end of the primer sequence, as shown in SEQ ID NO.3; add the XhoI endonuclease recognition site sequence GGTGGTGGTGCTCGAG at the 3' end, as shown in SEQ ID NO.4 shown. The designed primer sequence is: F: AAGGAGATATACATA TGGACAACAAACCCCAAC, as shown in SEQ ID NO.5; R: GGTGGTGGTGCTCGAG CATGTCCCGCTGCTCGAT, as shown in SEQ ID NO.6. The spliced DNA is used as a template, and the primers added with adapters are used to amplify the mCry1Ia2 gene, and the gel extraction kit is used to recover and purify the mCry1Ia2 gene fragment. Digest pET30a with restriction endonucleases NdeI and XhoI, recover and purify. The two frag...
Embodiment 3
[0068] Example 3 Expression of mCry1Ia2 gene in transgenic plants and detection of toxicity of expression products
[0069] At the 5' and 3' ends of the primer sequence, respectively add the SmaI endonuclease recognition site sequence CTCTAGAGGATCCCC, as shown in SEQ ID NO.7; and TCGAGCTCGGTACCC, as shown in SEQ ID NO.8. The designed primers are: F: 5' CTCTAGAGG ATCCCC ATGGACAACAAACCCCAAC3', as shown in SEQ ID NO.9; R:5' TCGAGCTCGGTACCC CTACTACTCGAGTGTGGCAGT 3', as shown in SEQ ID NO.10, uses the synthesized mCry1Ia2 nucleotide sequence as a template, amplifies with primers with adapters, and recovers the target fragment with a gel recovery purification kit. At the same time, the plant expression vector pTF101 was digested with SmaI, and the pTF101 fragment after digestion was recovered and purified. The two fragments were ligated (In-Fusion HD cloning kit, Clontech) to construct the eukaryotic expression plasmid pTF101-mCry1Ia2 (the promoter is CaMV35S, and the marker g...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


